CU116270 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GTGAAAGTTGGTGTGACGTTGTTGGATAGTCGTCAAAGCGAAGTATGCCGTTGGAGAGCGATCTTGGTTCATCAGCTGTCGATTACGACTGGGACTTAAGCGAGATTAAAGCACAAAAACAAAATTTCCAAAAGAACGGATACAGGATTGTTATGAAGCGATCGCACAGTGAGCGTTACGATCCTGACGCTTTCAATGGAAAACCTAGTGGATCGGTTTGTAATACGAACTCGGTAATTGGTGGACGTGAGTCCGTGCGGAGCAAATCGG
BLAST of CU116270 vs. TrEMBL
Match: A0A0A0LKL3_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G076000 PE=4 SV=1) HSP 1 Score: 163.3 bits (412), Expect = 1.3e-37 Identity = 79/80 (98.75%), Postives = 80/80 (100.00%), Query Frame = 3
BLAST of CU116270 vs. NCBI nr
Match: gi|449470322|ref|XP_004152866.1| (PREDICTED: uncharacterized protein LOC101218582 [Cucumis sativus]) HSP 1 Score: 161.8 bits (408), Expect = 5.6e-37 Identity = 79/80 (98.75%), Postives = 80/80 (100.00%), Query Frame = 3
BLAST of CU116270 vs. NCBI nr
Match: gi|659082343|ref|XP_008441789.1| (PREDICTED: uncharacterized protein LOC103485843 [Cucumis melo]) HSP 1 Score: 144.1 bits (362), Expect = 1.2e-31 Identity = 69/80 (86.25%), Postives = 74/80 (92.50%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|