CU116225 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
AGCATGCGCCACCGAAACCAGCGAGAGAGACGATCATGATGGCAACACCGATGCTGATGAGGGGCCATTGGAGGAATTTGAGACAATCGGTGGTGTTGGCGCGGCTGCTCAGCCATACGCCGCCGCCGATGATGGGGAGGGAAAGGAGGAAGGTTATGAAGTTTAGAAGGCCGATTAAGTGGTTGCTGGCTCTCATGCTGGTGATATGTTCCTTGTGTTTTCTATTGTTTTTTTGGTTC
BLAST of CU116225 vs. Swiss-Prot
Match: TET3_ARATH (Tetraspanin-3 OS=Arabidopsis thaliana GN=TET3 PE=2 SV=1) HSP 1 Score: 119.0 bits (297), Expect = 2.3e-26 Identity = 52/65 (80.00%), Postives = 60/65 (92.31%), Query Frame = -2
BLAST of CU116225 vs. Swiss-Prot
Match: TET4_ARATH (Tetraspanin-4 OS=Arabidopsis thaliana GN=TET4 PE=3 SV=1) HSP 1 Score: 109.8 bits (273), Expect = 1.4e-23 Identity = 47/65 (72.31%), Postives = 58/65 (89.23%), Query Frame = -2
BLAST of CU116225 vs. Swiss-Prot
Match: TET8_ARATH (Tetraspanin-8 OS=Arabidopsis thaliana GN=TET8 PE=2 SV=1) HSP 1 Score: 78.2 bits (191), Expect = 4.5e-14 Identity = 33/64 (51.56%), Postives = 50/64 (78.12%), Query Frame = -2
BLAST of CU116225 vs. Swiss-Prot
Match: TET9_ARATH (Tetraspanin-9 OS=Arabidopsis thaliana GN=TET9 PE=2 SV=1) HSP 1 Score: 74.7 bits (182), Expect = 5.0e-13 Identity = 34/65 (52.31%), Postives = 48/65 (73.85%), Query Frame = -2
BLAST of CU116225 vs. Swiss-Prot
Match: TET7_ARATH (Tetraspanin-7 OS=Arabidopsis thaliana GN=TET7 PE=2 SV=1) HSP 1 Score: 74.3 bits (181), Expect = 6.6e-13 Identity = 32/65 (49.23%), Postives = 46/65 (70.77%), Query Frame = -2
BLAST of CU116225 vs. TrEMBL
Match: A0A0A0LS61_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G089490 PE=4 SV=1) HSP 1 Score: 133.7 bits (335), Expect = 1.0e-28 Identity = 65/65 (100.00%), Postives = 65/65 (100.00%), Query Frame = -2
BLAST of CU116225 vs. TrEMBL
Match: B9SK16_RICCO (Putative uncharacterized protein OS=Ricinus communis GN=RCOM_1398810 PE=3 SV=1) HSP 1 Score: 122.5 bits (306), Expect = 2.3e-25 Identity = 56/65 (86.15%), Postives = 62/65 (95.38%), Query Frame = -2
BLAST of CU116225 vs. TrEMBL
Match: A0A164ZAA7_DAUCA (Uncharacterized protein OS=Daucus carota subsp. sativus GN=DCAR_018839 PE=4 SV=1) HSP 1 Score: 122.5 bits (306), Expect = 2.3e-25 Identity = 57/65 (87.69%), Postives = 61/65 (93.85%), Query Frame = -2
BLAST of CU116225 vs. TrEMBL
Match: A0A0B2P8N9_GLYSO (Uncharacterized protein OS=Glycine soja GN=glysoja_024681 PE=3 SV=1) HSP 1 Score: 121.3 bits (303), Expect = 5.2e-25 Identity = 55/65 (84.62%), Postives = 61/65 (93.85%), Query Frame = -2
BLAST of CU116225 vs. TrEMBL
Match: F6GTX6_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_06s0004g03390 PE=3 SV=1) HSP 1 Score: 121.3 bits (303), Expect = 5.2e-25 Identity = 54/65 (83.08%), Postives = 61/65 (93.85%), Query Frame = -2
BLAST of CU116225 vs. NCBI nr
Match: gi|449459074|ref|XP_004147271.1| (PREDICTED: tetraspanin-3-like [Cucumis sativus]) HSP 1 Score: 132.1 bits (331), Expect = 4.2e-28 Identity = 65/65 (100.00%), Postives = 65/65 (100.00%), Query Frame = -2
BLAST of CU116225 vs. NCBI nr
Match: gi|659072111|ref|XP_008463449.1| (PREDICTED: tetraspanin-3-like [Cucumis melo]) HSP 1 Score: 130.2 bits (326), Expect = 1.6e-27 Identity = 63/65 (96.92%), Postives = 64/65 (98.46%), Query Frame = -2
BLAST of CU116225 vs. NCBI nr
Match: gi|694439391|ref|XP_009346587.1| (PREDICTED: tetraspanin-3-like [Pyrus x bretschneideri]) HSP 1 Score: 123.6 bits (309), Expect = 1.5e-25 Identity = 59/78 (75.64%), Postives = 66/78 (84.62%), Query Frame = -2
BLAST of CU116225 vs. NCBI nr
Match: gi|658055464|ref|XP_008363477.1| (PREDICTED: tetraspanin-3-like [Malus domestica]) HSP 1 Score: 121.7 bits (304), Expect = 5.7e-25 Identity = 59/74 (79.73%), Postives = 64/74 (86.49%), Query Frame = -2
BLAST of CU116225 vs. NCBI nr
Match: gi|255570765|ref|XP_002526335.1| (PREDICTED: tetraspanin-3 [Ricinus communis]) HSP 1 Score: 120.9 bits (302), Expect = 9.8e-25 Identity = 56/65 (86.15%), Postives = 62/65 (95.38%), Query Frame = -2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|