CU115426 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGATATTCATCTACCTGTTGATGAGAAGAATAGAGATCCGTCTCAGGTGCTATATTGTTCACGACATATGCTGGAGGTGGAAGCACGCTGATTTCTGATGGATATATGGGAGCCTGGTACCCATTCCAGTCTTGATCTTGAGATGGTGAAATCATAGCAGGTACAAATGTTGTGGCTTCATTAAGTACTCTTGGTGAAGTCCATGATGTGATCTGTGATTGGGA
BLAST of CU115426 vs. Swiss-Prot
Match: C3H43_ARATH (Zinc finger CCCH domain-containing protein 43 OS=Arabidopsis thaliana GN=At3g48440 PE=2 SV=1) HSP 1 Score: 60.8 bits (146), Expect = 7.0e-09 Identity = 31/72 (43.06%), Postives = 42/72 (58.33%), Query Frame = -1
BLAST of CU115426 vs. TrEMBL
Match: A0A0A0LU93_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G050060 PE=4 SV=1) HSP 1 Score: 156.4 bits (394), Expect = 1.4e-35 Identity = 74/74 (100.00%), Postives = 74/74 (100.00%), Query Frame = -1
BLAST of CU115426 vs. TrEMBL
Match: E5GBX3_CUCME (Nucleic acid binding protein OS=Cucumis melo subsp. melo PE=4 SV=1) HSP 1 Score: 149.1 bits (375), Expect = 2.2e-33 Identity = 70/74 (94.59%), Postives = 71/74 (95.95%), Query Frame = -1
BLAST of CU115426 vs. TrEMBL
Match: D7SHC4_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_17s0000g09990 PE=4 SV=1) HSP 1 Score: 85.9 bits (211), Expect = 2.3e-14 Identity = 41/78 (52.56%), Postives = 53/78 (67.95%), Query Frame = -1
BLAST of CU115426 vs. TrEMBL
Match: B9I3K6_POPTR (Uncharacterized protein OS=Populus trichocarpa GN=POPTR_0012s09400g PE=4 SV=1) HSP 1 Score: 85.1 bits (209), Expect = 3.9e-14 Identity = 42/82 (51.22%), Postives = 56/82 (68.29%), Query Frame = -1
BLAST of CU115426 vs. TrEMBL
Match: I1K073_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_05G044300 PE=4 SV=1) HSP 1 Score: 84.0 bits (206), Expect = 8.6e-14 Identity = 41/82 (50.00%), Postives = 56/82 (68.29%), Query Frame = -1
BLAST of CU115426 vs. NCBI nr
Match: gi|449469596|ref|XP_004152505.1| (PREDICTED: zinc finger CCCH domain-containing protein 43 isoform X2 [Cucumis sativus]) HSP 1 Score: 154.8 bits (390), Expect = 5.7e-35 Identity = 74/74 (100.00%), Postives = 74/74 (100.00%), Query Frame = -1
BLAST of CU115426 vs. NCBI nr
Match: gi|778657993|ref|XP_011651926.1| (PREDICTED: zinc finger CCCH domain-containing protein 43 isoform X1 [Cucumis sativus]) HSP 1 Score: 154.8 bits (390), Expect = 5.7e-35 Identity = 74/74 (100.00%), Postives = 74/74 (100.00%), Query Frame = -1
BLAST of CU115426 vs. NCBI nr
Match: gi|778657996|ref|XP_011651936.1| (PREDICTED: zinc finger CCCH domain-containing protein 43 isoform X3 [Cucumis sativus]) HSP 1 Score: 154.8 bits (390), Expect = 5.7e-35 Identity = 74/74 (100.00%), Postives = 74/74 (100.00%), Query Frame = -1
BLAST of CU115426 vs. NCBI nr
Match: gi|659067397|ref|XP_008439243.1| (PREDICTED: zinc finger CCCH domain-containing protein 43 [Cucumis melo]) HSP 1 Score: 147.5 bits (371), Expect = 9.1e-33 Identity = 70/74 (94.59%), Postives = 71/74 (95.95%), Query Frame = -1
BLAST of CU115426 vs. NCBI nr
Match: gi|225456787|ref|XP_002277300.1| (PREDICTED: zinc finger CCCH domain-containing protein 67 [Vitis vinifera]) HSP 1 Score: 84.3 bits (207), Expect = 9.5e-14 Identity = 41/78 (52.56%), Postives = 53/78 (67.95%), Query Frame = -1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|