CU114682 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CAGAGCGGGCGAGGTTGGCTGCGAAGAATATGGCCACTCGATTCACCGCAGCGCTTCCTAAAAAATGGAGTTACTGTTCCAAGTGCTCTTCTGCTCGTTCTTGTAGTACTTGTGGTGGCAGTGGGACGTTGAACTCTTAGTTAGAAATTTTAATAAAGTGATGAATTCTTTACAAATGTACATGAGAGTTTAGATCACAAACGCTGGTCTTATTGTTTAAAGGAAATTTGACTTTGTTCTTTTATGAGTTTGCTGAATCAGTTTAGAGTTAAACATATTGTAAATATTAACATTGACAAATAGGTGAATCTAATGCACAAGTCTTACAATGTTAAAAACAACATGAAAGGCAGCAAGTCAAATTAATTAAGAGAAAAAATTACAATGATGTATCTATTTGCG
BLAST of CU114682 vs. TrEMBL
Match: A0A0A0LVE3_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G097700 PE=4 SV=1) HSP 1 Score: 96.7 bits (239), Expect = 2.3e-17 Identity = 45/45 (100.00%), Postives = 45/45 (100.00%), Query Frame = 3
BLAST of CU114682 vs. TrEMBL
Match: B9HQM1_POPTR (Uncharacterized protein OS=Populus trichocarpa GN=POPTR_0009s01400g PE=4 SV=1) HSP 1 Score: 85.9 bits (211), Expect = 4.1e-14 Identity = 38/44 (86.36%), Postives = 41/44 (93.18%), Query Frame = 3
BLAST of CU114682 vs. TrEMBL
Match: F6GWA4_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_06s0061g00330 PE=4 SV=1) HSP 1 Score: 85.9 bits (211), Expect = 4.1e-14 Identity = 38/45 (84.44%), Postives = 42/45 (93.33%), Query Frame = 3
BLAST of CU114682 vs. TrEMBL
Match: A0A0B0NYK5_GOSAR (Chaperone DnaJ OS=Gossypium arboreum GN=F383_00815 PE=4 SV=1) HSP 1 Score: 82.8 bits (203), Expect = 3.5e-13 Identity = 36/44 (81.82%), Postives = 40/44 (90.91%), Query Frame = 3
BLAST of CU114682 vs. TrEMBL
Match: A0A0D2RYF8_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_009G110400 PE=4 SV=1) HSP 1 Score: 82.8 bits (203), Expect = 3.5e-13 Identity = 36/44 (81.82%), Postives = 40/44 (90.91%), Query Frame = 3
BLAST of CU114682 vs. NCBI nr
Match: gi|449459098|ref|XP_004147283.1| (PREDICTED: uncharacterized protein LOC101218484 isoform X1 [Cucumis sativus]) HSP 1 Score: 92.0 bits (227), Expect = 8.2e-16 Identity = 45/45 (100.00%), Postives = 45/45 (100.00%), Query Frame = 3
BLAST of CU114682 vs. NCBI nr
Match: gi|778659062|ref|XP_011653737.1| (PREDICTED: uncharacterized protein LOC101218484 isoform X2 [Cucumis sativus]) HSP 1 Score: 92.0 bits (227), Expect = 8.2e-16 Identity = 45/45 (100.00%), Postives = 45/45 (100.00%), Query Frame = 3
BLAST of CU114682 vs. NCBI nr
Match: gi|659072053|ref|XP_008463206.1| (PREDICTED: uncharacterized protein LOC103501412 isoform X1 [Cucumis melo]) HSP 1 Score: 90.1 bits (222), Expect = 3.1e-15 Identity = 44/45 (97.78%), Postives = 45/45 (100.00%), Query Frame = 3
BLAST of CU114682 vs. NCBI nr
Match: gi|659072055|ref|XP_008463215.1| (PREDICTED: uncharacterized protein LOC103501412 isoform X2 [Cucumis melo]) HSP 1 Score: 90.1 bits (222), Expect = 3.1e-15 Identity = 44/45 (97.78%), Postives = 45/45 (100.00%), Query Frame = 3
BLAST of CU114682 vs. NCBI nr
Match: gi|659072057|ref|XP_008463221.1| (PREDICTED: uncharacterized protein LOC103501412 isoform X3 [Cucumis melo]) HSP 1 Score: 90.1 bits (222), Expect = 3.1e-15 Identity = 44/45 (97.78%), Postives = 45/45 (100.00%), Query Frame = 3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|