CU114545 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
ACTGTTCCACCAGTTTTCCTGTATTATTGGGCGATGGGGGTCATGACTTGTTAGAAATTAATAAGCTAGATACATTATGGATAACAAATTAATAGATACATTTCTAGTTTCAAGATACATATGCATTTCTAGATACATGTAATTATTCAAGTACATGAATGGTATGTATTCATGTACTTCATTTATTTTGTGTCTTTTAGGAAGTGTCTCTTGAATACTATATATATAGAG
BLAST of CU114545 vs. NCBI nr
Match: gi|778730310|ref|XP_011659756.1| (PREDICTED: UPF0481 protein At3g47200-like [Cucumis sativus]) HSP 1 Score: 110.2 bits (274), Expect = 1.7e-21 Identity = 53/55 (96.36%), Postives = 54/55 (98.18%), Query Frame = -1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|