CU114314 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGGCGAGGAGGTAGGGTTCTAGCTTCGTTCAAACCCAGACTGTCGTAAAACCCATACTGCACACTCCAACAAGAAGGAAGAACCAACATGGGGCGTAGGATGCCGTTGGCCGGAATGGAAACCTCTATCATGGCTACCGACTCTGTAGAATTCATTGGCGTTTCTGTTCCTTCTTCCTCATCAAGAGAGGCTGCCATTACTTCCGTTGCTTCTCAAGCTACCACCTCATTG
BLAST of CU114314 vs. TrEMBL
Match: A0A0A0LLC2_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G150000 PE=4 SV=1) HSP 1 Score: 90.9 bits (224), Expect = 7.4e-16 Identity = 48/48 (100.00%), Postives = 48/48 (100.00%), Query Frame = 1
BLAST of CU114314 vs. NCBI nr
Match: gi|778668501|ref|XP_011649106.1| (PREDICTED: nuclear pore complex protein NUP160 isoform X1 [Cucumis sativus]) HSP 1 Score: 85.1 bits (209), Expect = 5.8e-14 Identity = 48/48 (100.00%), Postives = 48/48 (100.00%), Query Frame = 1
BLAST of CU114314 vs. NCBI nr
Match: gi|700206388|gb|KGN61507.1| (hypothetical protein Csa_2G150000 [Cucumis sativus]) HSP 1 Score: 85.1 bits (209), Expect = 5.8e-14 Identity = 48/48 (100.00%), Postives = 48/48 (100.00%), Query Frame = 1
BLAST of CU114314 vs. NCBI nr
Match: gi|778668504|ref|XP_011649107.1| (PREDICTED: nuclear pore complex protein NUP160 isoform X2 [Cucumis sativus]) HSP 1 Score: 85.1 bits (209), Expect = 5.8e-14 Identity = 48/48 (100.00%), Postives = 48/48 (100.00%), Query Frame = 1
BLAST of CU114314 vs. NCBI nr
Match: gi|778668507|ref|XP_011649108.1| (PREDICTED: nuclear pore complex protein NUP160 isoform X3 [Cucumis sativus]) HSP 1 Score: 85.1 bits (209), Expect = 5.8e-14 Identity = 48/48 (100.00%), Postives = 48/48 (100.00%), Query Frame = 1
BLAST of CU114314 vs. NCBI nr
Match: gi|778668511|ref|XP_011649109.1| (PREDICTED: nuclear pore complex protein NUP160 isoform X4 [Cucumis sativus]) HSP 1 Score: 85.1 bits (209), Expect = 5.8e-14 Identity = 48/48 (100.00%), Postives = 48/48 (100.00%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|