CU113482 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TGGAACAGCTGATGAAGTTGTTGATTGGTCCCATGGAAAACAACTTTGGGAGCTTTGCAAGCAAAAGTATGAACCTCTATGGCTAAGTGGAGGTGGACATTGCAATCTTGAGCTATACCCAT
BLAST of CU113482 vs. Swiss-Prot
Match: AB17B_XENTR (Protein ABHD17B OS=Xenopus tropicalis GN=abhd17b PE=2 SV=1) HSP 1 Score: 54.7 bits (130), Expect = 2.7e-07 Identity = 22/39 (56.41%), Postives = 28/39 (71.79%), Query Frame = 2
BLAST of CU113482 vs. Swiss-Prot
Match: AB17A_BOVIN (Protein ABHD17A OS=Bos taurus GN=ABHD17A PE=2 SV=1) HSP 1 Score: 54.7 bits (130), Expect = 2.7e-07 Identity = 22/39 (56.41%), Postives = 27/39 (69.23%), Query Frame = 2
BLAST of CU113482 vs. Swiss-Prot
Match: AB17A_MOUSE (Protein ABHD17A OS=Mus musculus GN=Abhd17a PE=1 SV=1) HSP 1 Score: 54.7 bits (130), Expect = 2.7e-07 Identity = 22/39 (56.41%), Postives = 27/39 (69.23%), Query Frame = 2
BLAST of CU113482 vs. Swiss-Prot
Match: AB17A_RAT (Protein ABHD17A OS=Rattus norvegicus GN=Abhd17a PE=2 SV=1) HSP 1 Score: 54.7 bits (130), Expect = 2.7e-07 Identity = 22/39 (56.41%), Postives = 27/39 (69.23%), Query Frame = 2
BLAST of CU113482 vs. Swiss-Prot
Match: AB17B_CHICK (Protein ABHD17B OS=Gallus gallus GN=ABHD17B PE=2 SV=1) HSP 1 Score: 54.7 bits (130), Expect = 2.7e-07 Identity = 22/39 (56.41%), Postives = 28/39 (71.79%), Query Frame = 2
BLAST of CU113482 vs. TrEMBL
Match: A0A0A0L0Q0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G410820 PE=4 SV=1) HSP 1 Score: 95.9 bits (237), Expect = 1.2e-17 Identity = 40/40 (100.00%), Postives = 40/40 (100.00%), Query Frame = 2
BLAST of CU113482 vs. TrEMBL
Match: A0A0V0I4X0_SOLCH (Putative alpha/beta hydrolase domain-containing protein 17B-like OS=Solanum chacoense PE=4 SV=1) HSP 1 Score: 90.1 bits (222), Expect = 6.5e-16 Identity = 37/40 (92.50%), Postives = 40/40 (100.00%), Query Frame = 2
BLAST of CU113482 vs. TrEMBL
Match: M1CHY4_SOLTU (Uncharacterized protein OS=Solanum tuberosum GN=PGSC0003DMG401026387 PE=4 SV=1) HSP 1 Score: 90.1 bits (222), Expect = 6.5e-16 Identity = 37/40 (92.50%), Postives = 40/40 (100.00%), Query Frame = 2
BLAST of CU113482 vs. TrEMBL
Match: A0A0D3CSV9_BRAOL (Uncharacterized protein OS=Brassica oleracea var. oleracea PE=4 SV=1) HSP 1 Score: 89.7 bits (221), Expect = 8.5e-16 Identity = 37/40 (92.50%), Postives = 39/40 (97.50%), Query Frame = 2
BLAST of CU113482 vs. TrEMBL
Match: A0A078IJ53_BRANA (BnaA02g30230D protein OS=Brassica napus GN=BnaA02g30230D PE=4 SV=1) HSP 1 Score: 89.7 bits (221), Expect = 8.5e-16 Identity = 37/40 (92.50%), Postives = 39/40 (97.50%), Query Frame = 2
BLAST of CU113482 vs. NCBI nr
Match: gi|778694559|ref|XP_011653830.1| (PREDICTED: alpha/beta hydrolase domain-containing protein 17B [Cucumis sativus]) HSP 1 Score: 98.6 bits (244), Expect = 2.6e-18 Identity = 40/40 (100.00%), Postives = 40/40 (100.00%), Query Frame = 2
BLAST of CU113482 vs. NCBI nr
Match: gi|659086749|ref|XP_008444091.1| (PREDICTED: alpha/beta hydrolase domain-containing protein 17B isoform X1 [Cucumis melo]) HSP 1 Score: 98.6 bits (244), Expect = 2.6e-18 Identity = 40/40 (100.00%), Postives = 40/40 (100.00%), Query Frame = 2
BLAST of CU113482 vs. NCBI nr
Match: gi|1009126107|ref|XP_015879973.1| (PREDICTED: protein ABHD17B-like [Ziziphus jujuba]) HSP 1 Score: 93.6 bits (231), Expect = 8.5e-17 Identity = 36/40 (90.00%), Postives = 39/40 (97.50%), Query Frame = 2
BLAST of CU113482 vs. NCBI nr
Match: gi|565383047|ref|XP_006357838.1| (PREDICTED: alpha/beta hydrolase domain-containing protein 17B [Solanum tuberosum]) HSP 1 Score: 92.8 bits (229), Expect = 1.4e-16 Identity = 37/40 (92.50%), Postives = 40/40 (100.00%), Query Frame = 2
BLAST of CU113482 vs. NCBI nr
Match: gi|923671545|ref|XP_013650845.1| (PREDICTED: alpha/beta hydrolase domain-containing protein 17C-like, partial [Brassica napus]) HSP 1 Score: 92.4 bits (228), Expect = 1.9e-16 Identity = 37/40 (92.50%), Postives = 39/40 (97.50%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|