CU112602 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CCAGTCGTCGGACTTGCCGTTCTGAACATCGTAACAACTTGGTTGCTCCGTGAAAATTCCTATGTCCTCCGGCGCCCTTAGGCTGTTTGATTCTCCTACAATCTGAATGTTACGGAAGTAGCCGGCTTTGCCGAAGCCCTCACCGGGGAAGTGGCCGCTACCCATCTGGGGTGGAAGTATGTTGGCCGTCGGATTCAGAGTTAACGACTTCGCCGCCCCATTCGATCATGGAGGCGCTGTCGGTGAGATAAGAAAATAAGAAGGCCGGCCAATACCCTAAAACGTACTTATTTCCGAATTGCATCCACCAGTTTCCTTCTTTAGGGTCCTTCCAAATGAGCAA
BLAST of CU112602 vs. TrEMBL
Match: A0A0A0KBL1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G430210 PE=4 SV=1) HSP 1 Score: 132.5 bits (332), Expect = 3.3e-28 Identity = 59/61 (96.72%), Postives = 59/61 (96.72%), Query Frame = -1
BLAST of CU112602 vs. TrEMBL
Match: A0A0A0KBL1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G430210 PE=4 SV=1) HSP 1 Score: 119.4 bits (298), Expect = 2.9e-24 Identity = 55/55 (100.00%), Postives = 55/55 (100.00%), Query Frame = -2
HSP 2 Score: 130.2 bits (326), Expect = 1.6e-27 Identity = 63/95 (66.32%), Postives = 68/95 (71.58%), Query Frame = -1
BLAST of CU112602 vs. TrEMBL
Match: A5BPH6_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VITISV_036996 PE=4 SV=1) HSP 1 Score: 85.1 bits (209), Expect = 6.0e-14 Identity = 38/55 (69.09%), Postives = 44/55 (80.00%), Query Frame = -2
HSP 2 Score: 130.2 bits (326), Expect = 1.6e-27 Identity = 63/95 (66.32%), Postives = 68/95 (71.58%), Query Frame = -1
BLAST of CU112602 vs. TrEMBL
Match: D7SLL3_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_06s0004g00410 PE=4 SV=1) HSP 1 Score: 85.1 bits (209), Expect = 6.0e-14 Identity = 38/55 (69.09%), Postives = 44/55 (80.00%), Query Frame = -2
HSP 2 Score: 129.8 bits (325), Expect = 2.1e-27 Identity = 58/73 (79.45%), Postives = 63/73 (86.30%), Query Frame = -1
BLAST of CU112602 vs. TrEMBL
Match: A0A0D2NDL6_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_001G241400 PE=4 SV=1) HSP 1 Score: 85.1 bits (209), Expect = 6.0e-14 Identity = 38/52 (73.08%), Postives = 43/52 (82.69%), Query Frame = -2
HSP 2 Score: 129.8 bits (325), Expect = 2.1e-27 Identity = 58/73 (79.45%), Postives = 63/73 (86.30%), Query Frame = -1
BLAST of CU112602 vs. NCBI nr
Match: gi|449436230|ref|XP_004135896.1| (PREDICTED: uncharacterized protein LOC101218833 [Cucumis sativus]) HSP 1 Score: 133.3 bits (334), Expect = 2.7e-28 Identity = 59/61 (96.72%), Postives = 59/61 (96.72%), Query Frame = -1
BLAST of CU112602 vs. NCBI nr
Match: gi|659122585|ref|XP_008461220.1| (PREDICTED: LOW QUALITY PROTEIN: uncharacterized protein LOC103499872 [Cucumis melo]) HSP 1 Score: 133.3 bits (334), Expect = 2.7e-28 Identity = 59/61 (96.72%), Postives = 59/61 (96.72%), Query Frame = -1
BLAST of CU112602 vs. NCBI nr
Match: gi|147798997|emb|CAN72570.1| (hypothetical protein VITISV_036996 [Vitis vinifera]) HSP 1 Score: 132.9 bits (333), Expect = 3.6e-28 Identity = 63/95 (66.32%), Postives = 68/95 (71.58%), Query Frame = -1
BLAST of CU112602 vs. NCBI nr
Match: gi|297746485|emb|CBI16541.3| (unnamed protein product [Vitis vinifera]) HSP 1 Score: 132.9 bits (333), Expect = 3.6e-28 Identity = 63/95 (66.32%), Postives = 68/95 (71.58%), Query Frame = -1
BLAST of CU112602 vs. NCBI nr
Match: gi|225435772|ref|XP_002285729.1| (PREDICTED: uncharacterized protein LOC100267227 [Vitis vinifera]) HSP 1 Score: 132.9 bits (333), Expect = 3.6e-28 Identity = 63/95 (66.32%), Postives = 68/95 (71.58%), Query Frame = -1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|