CU112286 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CTTTTCCTAACCCGGAGTGACCCTCTTCTTCCTCCTTTGCTACATGAACAAAAACTTCAAAAGTATTTAACATTTCTCCATTAAATCAATCAATTTTCACCGAGGAGTAGATGAGTCTTGTGAACCAGAAACATGCGTAGAATCCAATTGTACCAGTCAGGACAAAGAAAGCGTATGAACCAATCAGCATATACCCAAAGTATAACATCCCTGACACCGGCTTTGTTATATCAAGCTTTTGTGAAGAAGTAGAAGGCAGCATAGAGGAAGAGGTAGAGTGCAGAGGAGCCTGAAGTCAGATATGATCTCCACCACAATGGTAGTCCTCACTGCCACAGTTGGAAGTAGCAGA
BLAST of CU112286 vs. Swiss-Prot
Match: TMN8_ARATH (Transmembrane 9 superfamily member 8 OS=Arabidopsis thaliana GN=TMN8 PE=2 SV=1) HSP 1 Score: 94.0 bits (232), Expect = 1.2e-18 Identity = 45/50 (90.00%), Postives = 43/50 (86.00%), Query Frame = -1
HSP 2 Score: 36.6 bits (83), Expect = 2.2e-01 Identity = 16/23 (69.57%), Postives = 14/23 (60.87%), Query Frame = -3
BLAST of CU112286 vs. Swiss-Prot
Match: TMN9_ARATH (Transmembrane 9 superfamily member 9 OS=Arabidopsis thaliana GN=TMN9 PE=2 SV=1) HSP 1 Score: 94.0 bits (232), Expect = 1.2e-18 Identity = 45/50 (90.00%), Postives = 43/50 (86.00%), Query Frame = -1
HSP 2 Score: 36.6 bits (83), Expect = 2.2e-01 Identity = 16/23 (69.57%), Postives = 14/23 (60.87%), Query Frame = -3
BLAST of CU112286 vs. Swiss-Prot
Match: TMN7_ARATH (Transmembrane 9 superfamily member 7 OS=Arabidopsis thaliana GN=TMN7 PE=2 SV=1) HSP 1 Score: 92.8 bits (229), Expect = 2.6e-18 Identity = 44/50 (88.00%), Postives = 44/50 (88.00%), Query Frame = -1
HSP 2 Score: 34.7 bits (78), Expect = 8.5e-01 Identity = 14/23 (60.87%), Postives = 14/23 (60.87%), Query Frame = -3
BLAST of CU112286 vs. Swiss-Prot
Match: TMN10_ARATH (Transmembrane 9 superfamily member 10 OS=Arabidopsis thaliana GN=TMN10 PE=2 SV=1) HSP 1 Score: 89.4 bits (220), Expect = 2.9e-17 Identity = 42/50 (84.00%), Postives = 42/50 (84.00%), Query Frame = -1
HSP 2 Score: 37.4 bits (85), Expect = 1.3e-01 Identity = 16/23 (69.57%), Postives = 14/23 (60.87%), Query Frame = -3
BLAST of CU112286 vs. Swiss-Prot
Match: TMN6_ARATH (Transmembrane 9 superfamily member 6 OS=Arabidopsis thaliana GN=TMN6 PE=2 SV=1) HSP 1 Score: 84.7 bits (208), Expect = 7.2e-16 Identity = 39/50 (78.00%), Postives = 43/50 (86.00%), Query Frame = -1
HSP 2 Score: 30.8 bits (68), Expect = 1.2e+01 Identity = 14/23 (60.87%), Postives = 13/23 (56.52%), Query Frame = -3
BLAST of CU112286 vs. TrEMBL
Match: A0A0A0LTQ4_CUCSA (Transmembrane 9 superfamily member OS=Cucumis sativus GN=Csa_1G256720 PE=3 SV=1) HSP 1 Score: 107.1 bits (266), Expect = 1.5e-20 Identity = 50/50 (100.00%), Postives = 50/50 (100.00%), Query Frame = -1
BLAST of CU112286 vs. TrEMBL
Match: A0A0A0LTQ4_CUCSA (Transmembrane 9 superfamily member OS=Cucumis sativus GN=Csa_1G256720 PE=3 SV=1) HSP 1 Score: 37.0 bits (84), Expect = 1.9e+01 Identity = 16/23 (69.57%), Postives = 16/23 (69.57%), Query Frame = -3
HSP 2 Score: 103.2 bits (256), Expect = 2.2e-19 Identity = 48/50 (96.00%), Postives = 49/50 (98.00%), Query Frame = -1
BLAST of CU112286 vs. TrEMBL
Match: A0A0V0IL33_SOLCH (Transmembrane 9 superfamily member OS=Solanum chacoense PE=3 SV=1) HSP 1 Score: 36.6 bits (83), Expect = 2.5e+01 Identity = 16/23 (69.57%), Postives = 16/23 (69.57%), Query Frame = -3
HSP 2 Score: 103.2 bits (256), Expect = 2.2e-19 Identity = 48/50 (96.00%), Postives = 49/50 (98.00%), Query Frame = -1
BLAST of CU112286 vs. TrEMBL
Match: K4CB31_SOLLC (Transmembrane 9 superfamily member OS=Solanum lycopersicum PE=3 SV=1) HSP 1 Score: 36.6 bits (83), Expect = 2.5e+01 Identity = 16/23 (69.57%), Postives = 16/23 (69.57%), Query Frame = -3
HSP 2 Score: 103.2 bits (256), Expect = 2.2e-19 Identity = 48/50 (96.00%), Postives = 49/50 (98.00%), Query Frame = -1
BLAST of CU112286 vs. TrEMBL
Match: M1CHH8_SOLTU (Transmembrane 9 superfamily member OS=Solanum tuberosum GN=PGSC0003DMG402026272 PE=3 SV=1) HSP 1 Score: 36.6 bits (83), Expect = 2.5e+01 Identity = 16/23 (69.57%), Postives = 16/23 (69.57%), Query Frame = -3
HSP 2 Score: 103.2 bits (256), Expect = 2.2e-19 Identity = 48/50 (96.00%), Postives = 49/50 (98.00%), Query Frame = -1
BLAST of CU112286 vs. NCBI nr
Match: gi|449457879|ref|XP_004146675.1| (PREDICTED: transmembrane 9 superfamily member 9-like [Cucumis sativus]) HSP 1 Score: 104.4 bits (259), Expect = 1.4e-19 Identity = 50/50 (100.00%), Postives = 50/50 (100.00%), Query Frame = -1
BLAST of CU112286 vs. NCBI nr
Match: gi|659086301|ref|XP_008443860.1| (PREDICTED: transmembrane 9 superfamily member 4-like [Cucumis melo]) HSP 1 Score: 102.8 bits (255), Expect = 4.1e-19 Identity = 49/50 (98.00%), Postives = 50/50 (100.00%), Query Frame = -1
BLAST of CU112286 vs. NCBI nr
Match: gi|747073975|ref|XP_011083969.1| (PREDICTED: transmembrane 9 superfamily member 8 [Sesamum indicum]) HSP 1 Score: 100.9 bits (250), Expect = 1.5e-18 Identity = 48/50 (96.00%), Postives = 50/50 (100.00%), Query Frame = -1
BLAST of CU112286 vs. NCBI nr
Match: gi|747065530|ref|XP_011079404.1| (PREDICTED: transmembrane 9 superfamily member 9-like [Sesamum indicum]) HSP 1 Score: 100.9 bits (250), Expect = 1.5e-18 Identity = 48/50 (96.00%), Postives = 50/50 (100.00%), Query Frame = -1
BLAST of CU112286 vs. NCBI nr
Match: gi|902150717|gb|KNA05446.1| (hypothetical protein SOVF_190210 [Spinacia oleracea]) HSP 1 Score: 100.5 bits (249), Expect = 2.0e-18 Identity = 48/50 (96.00%), Postives = 49/50 (98.00%), Query Frame = -1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|