CU112124 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CCATGTGAGCAGTGACGTAGTTGTTGTCTTGTTGCTGTTGTGATACTAGTAGGATTATTCAGCTTGCAACGCTATGGTACTGATAGAGTTGGTTGGCTCTTTGCTCCAGTTGTCCTACTCTGGTTTTTTTTTAATTGGAGGTATAGGCATGTTCAACATCTGGAAATATGATAAAACCATTCTAAGAGCCTTTTCACCTGTGTATATTGTTCGCTATTTTAGAAGGCGAGGGATGGATGGTTGG
BLAST of CU112124 vs. Swiss-Prot
Match: POT9_ARATH (Potassium transporter 9 OS=Arabidopsis thaliana GN=POT9 PE=2 SV=2) HSP 1 Score: 66.6 bits (161), Expect = 1.4e-10 Identity = 27/35 (77.14%), Postives = 31/35 (88.57%), Query Frame = 1
HSP 2 Score: 60.8 bits (146), Expect = 7.7e-09 Identity = 25/40 (62.50%), Postives = 28/40 (70.00%), Query Frame = 2
BLAST of CU112124 vs. Swiss-Prot
Match: POT10_ARATH (Potassium transporter 10 OS=Arabidopsis thaliana GN=POT10 PE=2 SV=2) HSP 1 Score: 63.9 bits (154), Expect = 9.1e-10 Identity = 28/35 (80.00%), Postives = 29/35 (82.86%), Query Frame = 1
HSP 2 Score: 63.5 bits (153), Expect = 1.2e-09 Identity = 26/40 (65.00%), Postives = 29/40 (72.50%), Query Frame = 2
BLAST of CU112124 vs. Swiss-Prot
Match: HAK12_ORYSJ (Putative potassium transporter 12 OS=Oryza sativa subsp. japonica GN=HAK12 PE=2 SV=1) HSP 1 Score: 63.9 bits (154), Expect = 9.1e-10 Identity = 26/33 (78.79%), Postives = 30/33 (90.91%), Query Frame = 1
HSP 2 Score: 52.0 bits (123), Expect = 3.6e-06 Identity = 22/40 (55.00%), Postives = 27/40 (67.50%), Query Frame = 2
BLAST of CU112124 vs. Swiss-Prot
Match: HAK11_ORYSJ (Probable potassium transporter 11 OS=Oryza sativa subsp. japonica GN=HAK11 PE=2 SV=4) HSP 1 Score: 63.2 bits (152), Expect = 1.6e-09 Identity = 25/33 (75.76%), Postives = 30/33 (90.91%), Query Frame = 1
HSP 2 Score: 54.3 bits (129), Expect = 7.2e-07 Identity = 22/40 (55.00%), Postives = 27/40 (67.50%), Query Frame = 2
BLAST of CU112124 vs. Swiss-Prot
Match: POT11_ARATH (Potassium transporter 11 OS=Arabidopsis thaliana GN=POT11 PE=2 SV=1) HSP 1 Score: 61.2 bits (147), Expect = 5.9e-09 Identity = 27/32 (84.38%), Postives = 27/32 (84.38%), Query Frame = 1
HSP 2 Score: 61.2 bits (147), Expect = 5.9e-09 Identity = 25/40 (62.50%), Postives = 29/40 (72.50%), Query Frame = 2
BLAST of CU112124 vs. TrEMBL
Match: A0A0A0LRC4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G057060 PE=4 SV=1) HSP 1 Score: 90.1 bits (222), Expect = 1.3e-15 Identity = 40/40 (100.00%), Postives = 40/40 (100.00%), Query Frame = 2
BLAST of CU112124 vs. TrEMBL
Match: A0A0A0LRC4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G057060 PE=4 SV=1) HSP 1 Score: 73.2 bits (178), Expect = 1.7e-10 Identity = 38/47 (80.85%), Postives = 39/47 (82.98%), Query Frame = 1
HSP 2 Score: 73.6 bits (179), Expect = 1.3e-10 Identity = 31/40 (77.50%), Postives = 34/40 (85.00%), Query Frame = 2
BLAST of CU112124 vs. TrEMBL
Match: A0A067GCK3_CITSI (Potassium transporter OS=Citrus sinensis GN=CISIN_1g003514mg PE=3 SV=1) HSP 1 Score: 67.8 bits (164), Expect = 7.0e-09 Identity = 31/33 (93.94%), Postives = 32/33 (96.97%), Query Frame = 1
HSP 2 Score: 73.6 bits (179), Expect = 1.3e-10 Identity = 31/40 (77.50%), Postives = 34/40 (85.00%), Query Frame = 2
BLAST of CU112124 vs. TrEMBL
Match: A0A067GF96_CITSI (Potassium transporter OS=Citrus sinensis GN=CISIN_1g003514mg PE=3 SV=1) HSP 1 Score: 67.8 bits (164), Expect = 7.0e-09 Identity = 31/33 (93.94%), Postives = 32/33 (96.97%), Query Frame = 1
HSP 2 Score: 73.6 bits (179), Expect = 1.3e-10 Identity = 31/40 (77.50%), Postives = 34/40 (85.00%), Query Frame = 2
BLAST of CU112124 vs. TrEMBL
Match: A0A067GPS3_CITSI (Potassium transporter OS=Citrus sinensis GN=CISIN_1g003514mg PE=3 SV=1) HSP 1 Score: 67.8 bits (164), Expect = 7.0e-09 Identity = 31/33 (93.94%), Postives = 32/33 (96.97%), Query Frame = 1
HSP 2 Score: 73.6 bits (179), Expect = 1.3e-10 Identity = 31/40 (77.50%), Postives = 34/40 (85.00%), Query Frame = 2
BLAST of CU112124 vs. NCBI nr
Match: gi|778658295|ref|XP_011652452.1| (PREDICTED: potassium transporter 10-like [Cucumis sativus]) HSP 1 Score: 90.1 bits (222), Expect = 1.9e-15 Identity = 40/40 (100.00%), Postives = 40/40 (100.00%), Query Frame = 2
BLAST of CU112124 vs. NCBI nr
Match: gi|700209374|gb|KGN64470.1| (hypothetical protein Csa_1G057060 [Cucumis sativus]) HSP 1 Score: 90.1 bits (222), Expect = 1.9e-15 Identity = 40/40 (100.00%), Postives = 40/40 (100.00%), Query Frame = 2
BLAST of CU112124 vs. NCBI nr
Match: gi|659067648|ref|XP_008440560.1| (PREDICTED: potassium transporter 11-like [Cucumis melo]) HSP 1 Score: 87.8 bits (216), Expect = 9.4e-15 Identity = 39/40 (97.50%), Postives = 39/40 (97.50%), Query Frame = 2
BLAST of CU112124 vs. NCBI nr
Match: gi|970010222|ref|XP_015065997.1| (PREDICTED: potassium transporter 11 [Solanum pennellii]) HSP 1 Score: 73.6 bits (179), Expect = 1.8e-10 Identity = 30/40 (75.00%), Postives = 35/40 (87.50%), Query Frame = 2
BLAST of CU112124 vs. NCBI nr
Match: gi|641858598|gb|KDO77320.1| (hypothetical protein CISIN_1g003514mg [Citrus sinensis]) HSP 1 Score: 73.6 bits (179), Expect = 1.8e-10 Identity = 31/40 (77.50%), Postives = 34/40 (85.00%), Query Frame = 2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|