CU112049 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGGCCGGGGGTCTACTTTAAATGAAGTGAGTATGGCGGTGAGTGACGAAGATGCTCATGTTGCAAGGCTTAAGGGGAAATATGCTGCAATGGTTGTGTGCTGGCTTCTTGGGAATGGATGCCTCTTTTCTTGGAACAGTATGCTGACCATTGAAGATTACTATGGCTATTTGTTCCCGAAATACCACTCTTCAAGAGTTCTTACTCTTGTGTATCAGCCGTTTGCCCTCGTAACAAT
BLAST of CU112049 vs. Swiss-Prot
Match: ENT3_ARATH (Equilibrative nucleotide transporter 3 OS=Arabidopsis thaliana GN=ENT3 PE=1 SV=1) HSP 1 Score: 87.8 bits (216), Expect = 5.7e-17 Identity = 45/68 (66.18%), Postives = 48/68 (70.59%), Query Frame = 2
BLAST of CU112049 vs. Swiss-Prot
Match: ENT2_ARATH (Equilibrative nucleotide transporter 2 OS=Arabidopsis thaliana GN=ENT2 PE=2 SV=1) HSP 1 Score: 85.9 bits (211), Expect = 2.2e-16 Identity = 36/53 (67.92%), Postives = 41/53 (77.36%), Query Frame = 2
BLAST of CU112049 vs. Swiss-Prot
Match: ENT4_ARATH (Equilibrative nucleotide transporter 4 OS=Arabidopsis thaliana GN=ENT4 PE=1 SV=1) HSP 1 Score: 85.9 bits (211), Expect = 2.2e-16 Identity = 43/68 (63.24%), Postives = 46/68 (67.65%), Query Frame = 2
BLAST of CU112049 vs. Swiss-Prot
Match: ENT5_ARATH (Equilibrative nucleotide transporter 5 OS=Arabidopsis thaliana GN=ENT5 PE=2 SV=1) HSP 1 Score: 79.3 bits (194), Expect = 2.0e-14 Identity = 38/68 (55.88%), Postives = 44/68 (64.71%), Query Frame = 2
BLAST of CU112049 vs. Swiss-Prot
Match: ENT6_ARATH (Equilibrative nucleotide transporter 6 OS=Arabidopsis thaliana GN=ENT6 PE=1 SV=1) HSP 1 Score: 79.0 bits (193), Expect = 2.6e-14 Identity = 37/54 (68.52%), Postives = 40/54 (74.07%), Query Frame = 2
BLAST of CU112049 vs. TrEMBL
Match: A0A0A0LW80_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G192690 PE=4 SV=1) HSP 1 Score: 145.6 bits (366), Expect = 2.5e-32 Identity = 68/68 (100.00%), Postives = 68/68 (100.00%), Query Frame = 2
BLAST of CU112049 vs. TrEMBL
Match: W9RAP5_9ROSA (Equilibrative nucleoside transporter 4 OS=Morus notabilis GN=L484_022213 PE=4 SV=1) HSP 1 Score: 117.9 bits (294), Expect = 5.7e-24 Identity = 56/68 (82.35%), Postives = 60/68 (88.24%), Query Frame = 2
BLAST of CU112049 vs. TrEMBL
Match: A0A061E4K8_THECC (Major facilitator superfamily protein isoform 2 OS=Theobroma cacao GN=TCM_007894 PE=4 SV=1) HSP 1 Score: 116.3 bits (290), Expect = 1.7e-23 Identity = 53/57 (92.98%), Postives = 54/57 (94.74%), Query Frame = 2
BLAST of CU112049 vs. TrEMBL
Match: A0A061E2V7_THECC (Major facilitator superfamily protein isoform 1 OS=Theobroma cacao GN=TCM_007894 PE=4 SV=1) HSP 1 Score: 116.3 bits (290), Expect = 1.7e-23 Identity = 53/57 (92.98%), Postives = 54/57 (94.74%), Query Frame = 2
BLAST of CU112049 vs. TrEMBL
Match: C6T8P0_SOYBN (Putative uncharacterized protein OS=Glycine max PE=2 SV=1) HSP 1 Score: 115.9 bits (289), Expect = 2.2e-23 Identity = 52/57 (91.23%), Postives = 55/57 (96.49%), Query Frame = 2
BLAST of CU112049 vs. NCBI nr
Match: gi|659118126|ref|XP_008458960.1| (PREDICTED: equilibrative nucleotide transporter 3-like isoform X1 [Cucumis melo]) HSP 1 Score: 152.1 bits (383), Expect = 3.9e-34 Identity = 73/75 (97.33%), Postives = 73/75 (97.33%), Query Frame = 2
BLAST of CU112049 vs. NCBI nr
Match: gi|700209976|gb|KGN65072.1| (hypothetical protein Csa_1G192690 [Cucumis sativus]) HSP 1 Score: 144.8 bits (364), Expect = 6.2e-32 Identity = 68/68 (100.00%), Postives = 68/68 (100.00%), Query Frame = 2
BLAST of CU112049 vs. NCBI nr
Match: gi|659118128|ref|XP_008458961.1| (PREDICTED: equilibrative nucleotide transporter 3-like isoform X2 [Cucumis melo]) HSP 1 Score: 139.8 bits (351), Expect = 2.0e-30 Identity = 66/68 (97.06%), Postives = 66/68 (97.06%), Query Frame = 2
BLAST of CU112049 vs. NCBI nr
Match: gi|1009127990|ref|XP_015880986.1| (PREDICTED: equilibrative nucleotide transporter 3-like [Ziziphus jujuba]) HSP 1 Score: 118.6 bits (296), Expect = 4.8e-24 Identity = 55/64 (85.94%), Postives = 57/64 (89.06%), Query Frame = 2
BLAST of CU112049 vs. NCBI nr
Match: gi|703096481|ref|XP_010095856.1| (Equilibrative nucleoside transporter 4 [Morus notabilis]) HSP 1 Score: 117.1 bits (292), Expect = 1.4e-23 Identity = 56/68 (82.35%), Postives = 60/68 (88.24%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|