CU112035 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CAACCTTTGCTACATATTTAGAGTCTAATAATATATTGCTGGACTTGATATCTCGATGGAATATTGGAGGATCAGCTTCCGTATGCAGATACAGAATTCCCTTAGCTGCACCCAGGGCGGCTTTTAATCTTGTGGCAAAACTCAAAGGTTCTGCAGAATTTACAGAAAGGTGATCCCTCAGCGTGCCATTTGACATAAATTCATAAGCCAACATCTGCTCCCCTTCTTCCCCGGCCG
BLAST of CU112035 vs. Swiss-Prot
Match: Y1684_ARATH (Probable LRR receptor-like serine/threonine-protein kinase At1g06840 OS=Arabidopsis thaliana GN=At1g06840 PE=2 SV=2) HSP 1 Score: 104.8 bits (260), Expect = 4.5e-22 Identity = 51/76 (67.11%), Postives = 56/76 (73.68%), Query Frame = -3
BLAST of CU112035 vs. Swiss-Prot
Match: Y5374_ARATH (Probable LRR receptor-like serine/threonine-protein kinase At5g37450 OS=Arabidopsis thaliana GN=At5g37450 PE=2 SV=1) HSP 1 Score: 90.1 bits (222), Expect = 1.1e-17 Identity = 46/76 (60.53%), Postives = 50/76 (65.79%), Query Frame = -3
BLAST of CU112035 vs. Swiss-Prot
Match: Y3359_ARATH (Putative leucine-rich repeat receptor-like serine/threonine-protein kinase At3g53590 OS=Arabidopsis thaliana GN=At3g53590 PE=3 SV=2) HSP 1 Score: 89.4 bits (220), Expect = 1.9e-17 Identity = 44/74 (59.46%), Postives = 51/74 (68.92%), Query Frame = -3
BLAST of CU112035 vs. Swiss-Prot
Match: ACCR1_ARATH (Serine/threonine-protein kinase-like protein CCR1 OS=Arabidopsis thaliana GN=CCR1 PE=1 SV=1) HSP 1 Score: 74.3 bits (181), Expect = 6.5e-13 Identity = 37/76 (48.68%), Postives = 49/76 (64.47%), Query Frame = -3
BLAST of CU112035 vs. Swiss-Prot
Match: ACCR4_ARATH (Serine/threonine-protein kinase-like protein CCR4 OS=Arabidopsis thaliana GN=CCR4 PE=1 SV=1) HSP 1 Score: 73.6 bits (179), Expect = 1.1e-12 Identity = 37/73 (50.68%), Postives = 44/73 (60.27%), Query Frame = -3
BLAST of CU112035 vs. TrEMBL
Match: A0A0A0LQ46_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G027520 PE=4 SV=1) HSP 1 Score: 120.2 bits (300), Expect = 1.1e-24 Identity = 61/71 (85.92%), Postives = 61/71 (85.92%), Query Frame = -3
BLAST of CU112035 vs. TrEMBL
Match: A0A061GZ11_THECC (Leucine-rich repeat protein kinase family protein isoform 1 OS=Theobroma cacao GN=TCM_042309 PE=3 SV=1) HSP 1 Score: 116.3 bits (290), Expect = 1.7e-23 Identity = 58/76 (76.32%), Postives = 60/76 (78.95%), Query Frame = -3
BLAST of CU112035 vs. TrEMBL
Match: A0A061H0G1_THECC (Leucine-rich repeat protein kinase family protein isoform 2 OS=Theobroma cacao GN=TCM_042309 PE=3 SV=1) HSP 1 Score: 116.3 bits (290), Expect = 1.7e-23 Identity = 58/76 (76.32%), Postives = 60/76 (78.95%), Query Frame = -3
BLAST of CU112035 vs. TrEMBL
Match: A0A0V0IWS3_SOLCH (Putative LRR receptor-like serine/threonine-protein kinase-like OS=Solanum chacoense PE=3 SV=1) HSP 1 Score: 114.8 bits (286), Expect = 4.8e-23 Identity = 57/77 (74.03%), Postives = 60/77 (77.92%), Query Frame = -3
BLAST of CU112035 vs. TrEMBL
Match: B9I771_POPTR (Uncharacterized protein OS=Populus trichocarpa GN=POPTR_0013s15520g PE=3 SV=2) HSP 1 Score: 113.6 bits (283), Expect = 1.1e-22 Identity = 56/76 (73.68%), Postives = 60/76 (78.95%), Query Frame = -3
BLAST of CU112035 vs. NCBI nr
Match: gi|449439195|ref|XP_004137372.1| (PREDICTED: probable LRR receptor-like serine/threonine-protein kinase At1g06840 [Cucumis sativus]) HSP 1 Score: 131.3 bits (329), Expect = 7.1e-28 Identity = 66/76 (86.84%), Postives = 66/76 (86.84%), Query Frame = -3
BLAST of CU112035 vs. NCBI nr
Match: gi|659114903|ref|XP_008457284.1| (PREDICTED: probable LRR receptor-like serine/threonine-protein kinase At1g06840 [Cucumis melo]) HSP 1 Score: 129.8 bits (325), Expect = 2.1e-27 Identity = 65/76 (85.53%), Postives = 66/76 (86.84%), Query Frame = -3
BLAST of CU112035 vs. NCBI nr
Match: gi|700208827|gb|KGN63923.1| (hypothetical protein Csa_1G027520 [Cucumis sativus]) HSP 1 Score: 121.7 bits (304), Expect = 5.7e-25 Identity = 61/71 (85.92%), Postives = 61/71 (85.92%), Query Frame = -3
BLAST of CU112035 vs. NCBI nr
Match: gi|1009116298|ref|XP_015874695.1| (PREDICTED: probable LRR receptor-like serine/threonine-protein kinase At1g06840 isoform X2 [Ziziphus jujuba]) HSP 1 Score: 117.9 bits (294), Expect = 8.2e-24 Identity = 57/76 (75.00%), Postives = 62/76 (81.58%), Query Frame = -3
BLAST of CU112035 vs. NCBI nr
Match: gi|1009116292|ref|XP_015874692.1| (PREDICTED: probable LRR receptor-like serine/threonine-protein kinase At1g06840 isoform X1 [Ziziphus jujuba]) HSP 1 Score: 117.9 bits (294), Expect = 8.2e-24 Identity = 57/76 (75.00%), Postives = 62/76 (81.58%), Query Frame = -3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|