CU111796 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TAGTTTGGTTGGTAAAGTTCAGTGTCTTTGATAGATCTGTTTTGGTATCTAATGGTGTTGTACATGACAAGCTTTTGGAGAAAATTGGTCCTGCAACAGAAAAACTAAAAAGCAAAGGAATTGAGTTCTCATTGTGGTATAAGCCAGAAAACTACCAGACAGATCTTTGAGTTATTCCTCTCAGTTTCACTTCTCAAGTCTCCAAACAATTGTTGCTGTGAGAGTTTGACTGAGTGAGTTGTTGGGATAAATACATAAAGAAATATCTTC
BLAST of CU111796 vs. Swiss-Prot
Match: IMPL1_ARATH (Phosphatase IMPL1, chloroplastic OS=Arabidopsis thaliana GN=IMPL1 PE=1 SV=2) HSP 1 Score: 89.0 bits (219), Expect = 2.9e-17 Identity = 41/51 (80.39%), Postives = 45/51 (88.24%), Query Frame = 3
BLAST of CU111796 vs. TrEMBL
Match: A0A0A0LYM3_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G185090 PE=4 SV=1) HSP 1 Score: 106.3 bits (264), Expect = 2.0e-20 Identity = 51/51 (100.00%), Postives = 51/51 (100.00%), Query Frame = 3
BLAST of CU111796 vs. TrEMBL
Match: A0A068URU4_COFCA (Uncharacterized protein OS=Coffea canephora GN=GSCOC_T00033341001 PE=4 SV=1) HSP 1 Score: 95.1 bits (235), Expect = 4.5e-17 Identity = 43/51 (84.31%), Postives = 50/51 (98.04%), Query Frame = 3
BLAST of CU111796 vs. TrEMBL
Match: A0A067JT37_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_00142 PE=4 SV=1) HSP 1 Score: 94.7 bits (234), Expect = 5.9e-17 Identity = 44/50 (88.00%), Postives = 48/50 (96.00%), Query Frame = 3
BLAST of CU111796 vs. TrEMBL
Match: U5FXE5_POPTR (Inositol monophosphatase family protein OS=Populus trichocarpa GN=POPTR_0012s12120g PE=4 SV=1) HSP 1 Score: 94.0 bits (232), Expect = 1.0e-16 Identity = 44/51 (86.27%), Postives = 48/51 (94.12%), Query Frame = 3
BLAST of CU111796 vs. TrEMBL
Match: B9ICN1_POPTR (Uncharacterized protein OS=Populus trichocarpa GN=POPTR_0015s15480g PE=4 SV=2) HSP 1 Score: 94.0 bits (232), Expect = 1.0e-16 Identity = 44/51 (86.27%), Postives = 48/51 (94.12%), Query Frame = 3
BLAST of CU111796 vs. NCBI nr
Match: gi|778659773|ref|XP_011655003.1| (PREDICTED: phosphatase IMPL1, chloroplastic [Cucumis sativus]) HSP 1 Score: 108.2 bits (269), Expect = 7.4e-21 Identity = 51/51 (100.00%), Postives = 51/51 (100.00%), Query Frame = 3
BLAST of CU111796 vs. NCBI nr
Match: gi|700209955|gb|KGN65051.1| (hypothetical protein Csa_1G185090 [Cucumis sativus]) HSP 1 Score: 108.2 bits (269), Expect = 7.4e-21 Identity = 51/51 (100.00%), Postives = 51/51 (100.00%), Query Frame = 3
BLAST of CU111796 vs. NCBI nr
Match: gi|659127282|ref|XP_008463623.1| (PREDICTED: phosphatase IMPL1, chloroplastic [Cucumis melo]) HSP 1 Score: 105.1 bits (261), Expect = 6.2e-20 Identity = 49/50 (98.00%), Postives = 49/50 (98.00%), Query Frame = 3
BLAST of CU111796 vs. NCBI nr
Match: gi|661885090|emb|CDP11230.1| (unnamed protein product [Coffea canephora]) HSP 1 Score: 97.1 bits (240), Expect = 1.7e-17 Identity = 43/51 (84.31%), Postives = 50/51 (98.04%), Query Frame = 3
BLAST of CU111796 vs. NCBI nr
Match: gi|643708032|gb|KDP23150.1| (hypothetical protein JCGZ_00142 [Jatropha curcas]) HSP 1 Score: 96.7 bits (239), Expect = 2.2e-17 Identity = 44/50 (88.00%), Postives = 48/50 (96.00%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|