CU111603 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CCAATGATCTCCTCCACTTAATAGGAAACACACATGATTACACCCAACAAACCAATTCTCCTCTTTCATATATTCCATCACATATAAAACTCTCTTCCTTTTCCCCCCCTTTTTTTCTTCCTCTTCTTCCTCACACCATTCATACACCCTCTCCTCTCAAATGGCTACTTCTTCTTCATGTACAGCCACCTCCCCTCCATGGCTTCTACCACTTCCTATCCCATGAGCTCGATGACCTCGACCACGCCTTCGTCTCCTCCGATTTCATGTCCCTTCACTTTCTCCAAAAAGTTCTTTCTCTTCTTAGAACTCTCCACTCTCAGCTCATCCAGCTTGGCCAACGCCTTCACCTCCCCGTCGGCGGTAA
BLAST of CU111603 vs. TrEMBL
Match: A0A0A0LC30_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G221740 PE=4 SV=1) HSP 1 Score: 114.8 bits (286), Expect = 7.5e-23 Identity = 55/55 (100.00%), Postives = 55/55 (100.00%), Query Frame = 3
BLAST of CU111603 vs. TrEMBL
Match: M1C717_SOLTU (Uncharacterized protein OS=Solanum tuberosum GN=PGSC0003DMG400023770 PE=4 SV=1) HSP 1 Score: 75.9 bits (185), Expect = 3.8e-11 Identity = 36/54 (66.67%), Postives = 43/54 (79.63%), Query Frame = 3
BLAST of CU111603 vs. TrEMBL
Match: K4B1X6_SOLLC (Uncharacterized protein OS=Solanum lycopersicum PE=4 SV=1) HSP 1 Score: 75.9 bits (185), Expect = 3.8e-11 Identity = 36/54 (66.67%), Postives = 43/54 (79.63%), Query Frame = 3
BLAST of CU111603 vs. TrEMBL
Match: M5XCS8_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa008717mg PE=4 SV=1) HSP 1 Score: 75.5 bits (184), Expect = 5.0e-11 Identity = 34/54 (62.96%), Postives = 45/54 (83.33%), Query Frame = 3
BLAST of CU111603 vs. TrEMBL
Match: A0A0B0PS05_GOSAR (Monofunctional biosynthetic peptidoglycan transglycosylase OS=Gossypium arboreum GN=F383_32784 PE=4 SV=1) HSP 1 Score: 74.7 bits (182), Expect = 8.6e-11 Identity = 36/74 (48.65%), Postives = 50/74 (67.57%), Query Frame = 3
BLAST of CU111603 vs. NCBI nr
Match: gi|659112110|ref|XP_008456067.1| (PREDICTED: uncharacterized protein LOC103496110 [Cucumis melo]) HSP 1 Score: 115.5 bits (288), Expect = 6.3e-23 Identity = 66/105 (62.86%), Postives = 68/105 (64.76%), Query Frame = 3
BLAST of CU111603 vs. NCBI nr
Match: gi|449457097|ref|XP_004146285.1| (PREDICTED: uncharacterized protein LOC101211523 [Cucumis sativus]) HSP 1 Score: 112.1 bits (279), Expect = 6.9e-22 Identity = 55/55 (100.00%), Postives = 55/55 (100.00%), Query Frame = 3
BLAST of CU111603 vs. NCBI nr
Match: gi|743764652|ref|XP_010912534.1| (PREDICTED: uncharacterized protein LOC105038420 [Elaeis guineensis]) HSP 1 Score: 73.6 bits (179), Expect = 2.7e-10 Identity = 36/54 (66.67%), Postives = 43/54 (79.63%), Query Frame = 3
BLAST of CU111603 vs. NCBI nr
Match: gi|565365327|ref|XP_006349366.1| (PREDICTED: uncharacterized protein LOC102603732 [Solanum tuberosum]) HSP 1 Score: 73.2 bits (178), Expect = 3.6e-10 Identity = 36/54 (66.67%), Postives = 43/54 (79.63%), Query Frame = 3
BLAST of CU111603 vs. NCBI nr
Match: gi|697102824|ref|XP_009603248.1| (PREDICTED: uncharacterized protein LOC104098263 [Nicotiana tomentosiformis]) HSP 1 Score: 73.2 bits (178), Expect = 3.6e-10 Identity = 36/54 (66.67%), Postives = 43/54 (79.63%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|