CU111468 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGCAAACGAGGCGGCGGCGGAGGCTTACCGGAAGCAATTTCAGACGGACTTGGCAGGGTTTTCTGTGGGCCAGGGCTCAGGAACTGAAGAGAGGTGGGTCCATGTTCCTTGTCTGCTTGGGCCGGACCTCACTCGACCCCACCGACCAAGGCGGAGCCGGCCTCCTCTTTGGGACCCACTTCAGGATGCTTGGGATGATCTTGTCCAAGAGGGATTGATAAGCAATGAGAAACGTGATAGCTTCAACATTCCAGTGTATGCACCGAGCTTACA
BLAST of CU111468 vs. Swiss-Prot
Match: IAMT1_ARATH (Indole-3-acetate O-methyltransferase 1 OS=Arabidopsis thaliana GN=IAMT1 PE=1 SV=1) HSP 1 Score: 79.3 bits (194), Expect = 2.3e-14 Identity = 39/57 (68.42%), Postives = 45/57 (78.95%), Query Frame = 3
HSP 2 Score: 68.9 bits (167), Expect = 3.1e-11 Identity = 38/90 (42.22%), Postives = 44/90 (48.89%), Query Frame = 2
BLAST of CU111468 vs. Swiss-Prot
Match: IAMT1_ORYSJ (Indole-3-acetate O-methyltransferase 1 OS=Oryza sativa subsp. japonica GN=IAMT1 PE=1 SV=1) HSP 1 Score: 73.6 bits (179), Expect = 1.3e-12 Identity = 41/90 (45.56%), Postives = 45/90 (50.00%), Query Frame = 2
BLAST of CU111468 vs. TrEMBL
Match: A0A0A0K2W3_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G081680 PE=4 SV=1) HSP 1 Score: 92.8 bits (229), Expect = 2.3e-16 Identity = 43/49 (87.76%), Postives = 45/49 (91.84%), Query Frame = 3
BLAST of CU111468 vs. TrEMBL
Match: A0A0A0K2W3_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G081680 PE=4 SV=1) HSP 1 Score: 91.7 bits (226), Expect = 5.0e-16 Identity = 52/90 (57.78%), Postives = 54/90 (60.00%), Query Frame = 2
HSP 2 Score: 84.3 bits (207), Expect = 8.0e-14 Identity = 39/49 (79.59%), Postives = 44/49 (89.80%), Query Frame = 3
BLAST of CU111468 vs. TrEMBL
Match: A0A067KSN8_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_00958 PE=4 SV=1) HSP 1 Score: 77.4 bits (189), Expect = 9.8e-12 Identity = 42/90 (46.67%), Postives = 52/90 (57.78%), Query Frame = 2
HSP 2 Score: 83.6 bits (205), Expect = 1.4e-13 Identity = 38/49 (77.55%), Postives = 44/49 (89.80%), Query Frame = 3
BLAST of CU111468 vs. TrEMBL
Match: B9SYY5_RICCO (Benzoate carboxyl methyltransferase, putative OS=Ricinus communis GN=RCOM_0546890 PE=4 SV=1) HSP 1 Score: 80.5 bits (197), Expect = 1.2e-12 Identity = 45/90 (50.00%), Postives = 52/90 (57.78%), Query Frame = 2
HSP 2 Score: 83.2 bits (204), Expect = 1.8e-13 Identity = 39/49 (79.59%), Postives = 43/49 (87.76%), Query Frame = 3
BLAST of CU111468 vs. TrEMBL
Match: V7BN94_PHAVU (Uncharacterized protein OS=Phaseolus vulgaris GN=PHAVU_006G048600g PE=4 SV=1) HSP 1 Score: 77.0 bits (188), Expect = 1.3e-11 Identity = 44/90 (48.89%), Postives = 50/90 (55.56%), Query Frame = 2
HSP 2 Score: 82.8 bits (203), Expect = 2.3e-13 Identity = 45/90 (50.00%), Postives = 53/90 (58.89%), Query Frame = 2
BLAST of CU111468 vs. NCBI nr
Match: gi|449467394|ref|XP_004151408.1| (PREDICTED: indole-3-acetate O-methyltransferase 1 [Cucumis sativus]) HSP 1 Score: 93.6 bits (231), Expect = 1.9e-16 Identity = 43/49 (87.76%), Postives = 45/49 (91.84%), Query Frame = 3
BLAST of CU111468 vs. NCBI nr
Match: gi|659093771|ref|XP_008447710.1| (PREDICTED: indole-3-acetate O-methyltransferase 1 [Cucumis melo]) HSP 1 Score: 91.3 bits (225), Expect = 9.4e-16 Identity = 41/42 (97.62%), Postives = 42/42 (100.00%), Query Frame = 3
BLAST of CU111468 vs. NCBI nr
Match: gi|729356523|ref|XP_010545250.1| (PREDICTED: indole-3-acetate O-methyltransferase 1 [Tarenaya hassleriana]) HSP 1 Score: 86.3 bits (212), Expect = 3.0e-14 Identity = 41/49 (83.67%), Postives = 43/49 (87.76%), Query Frame = 3
BLAST of CU111468 vs. NCBI nr
Match: gi|802588495|ref|XP_012070919.1| (PREDICTED: indole-3-acetate O-methyltransferase 1 [Jatropha curcas]) HSP 1 Score: 85.1 bits (209), Expect = 6.8e-14 Identity = 39/49 (79.59%), Postives = 44/49 (89.80%), Query Frame = 3
BLAST of CU111468 vs. NCBI nr
Match: gi|703097335|ref|XP_010096089.1| (Indole-3-acetate O-methyltransferase 1 [Morus notabilis]) HSP 1 Score: 84.3 bits (207), Expect = 1.2e-13 Identity = 45/90 (50.00%), Postives = 53/90 (58.89%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|