CU111388 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CAGCATCTATGCAGCTTTTCTATGGTCTTGCTTCGCTTTTCGAATGTATTTCTCGATTCCGGTTTTGAGCAAAAGAGCTCTGTTTTCTGGGTTCCTGACTACAAGATTTCGTATCATGTTACAGGAATTCCTTTGCATTTGTTGAGCTGAAGGGAACTTCTGCATAGCTTGAATGGCAAGATCTCCAGCTCCAGCTTCAATTGCCTGTGTTGCATTTTCTGGAGATCTCAACGTAAGCACTGATACAACGGCCATT
BLAST of CU111388 vs. Swiss-Prot
Match: ARMC6_MOUSE (Armadillo repeat-containing protein 6 OS=Mus musculus GN=Armc6 PE=1 SV=1) HSP 1 Score: 53.5 bits (127), Expect = 1.3e-06 Identity = 29/77 (37.66%), Postives = 41/77 (53.25%), Query Frame = -2
BLAST of CU111388 vs. Swiss-Prot
Match: ARMC6_PONAB (Armadillo repeat-containing protein 6 OS=Pongo abelii GN=ARMC6 PE=2 SV=1) HSP 1 Score: 52.4 bits (124), Expect = 2.9e-06 Identity = 27/78 (34.62%), Postives = 39/78 (50.00%), Query Frame = -2
BLAST of CU111388 vs. Swiss-Prot
Match: ARMC6_HUMAN (Armadillo repeat-containing protein 6 OS=Homo sapiens GN=ARMC6 PE=1 SV=2) HSP 1 Score: 52.0 bits (123), Expect = 3.8e-06 Identity = 27/78 (34.62%), Postives = 38/78 (48.72%), Query Frame = -2
BLAST of CU111388 vs. TrEMBL
Match: A0A0A0K4T9_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G074820 PE=4 SV=1) HSP 1 Score: 151.4 bits (381), Expect = 5.1e-34 Identity = 77/78 (98.72%), Postives = 78/78 (100.00%), Query Frame = -2
BLAST of CU111388 vs. TrEMBL
Match: A0A0B2QWH2_GLYSO (Armadillo repeat-containing protein 6 OS=Glycine soja GN=glysoja_047318 PE=4 SV=1) HSP 1 Score: 128.6 bits (322), Expect = 3.5e-27 Identity = 62/78 (79.49%), Postives = 71/78 (91.03%), Query Frame = -2
BLAST of CU111388 vs. TrEMBL
Match: I1KL23_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_07G178400 PE=4 SV=1) HSP 1 Score: 128.6 bits (322), Expect = 3.5e-27 Identity = 62/78 (79.49%), Postives = 71/78 (91.03%), Query Frame = -2
BLAST of CU111388 vs. TrEMBL
Match: I1KL25_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_07G178400 PE=4 SV=1) HSP 1 Score: 128.6 bits (322), Expect = 3.5e-27 Identity = 62/78 (79.49%), Postives = 71/78 (91.03%), Query Frame = -2
BLAST of CU111388 vs. TrEMBL
Match: V7C8E6_PHAVU (Uncharacterized protein OS=Phaseolus vulgaris GN=PHAVU_003G012500g PE=4 SV=1) HSP 1 Score: 127.9 bits (320), Expect = 6.0e-27 Identity = 62/78 (79.49%), Postives = 70/78 (89.74%), Query Frame = -2
BLAST of CU111388 vs. NCBI nr
Match: gi|449438432|ref|XP_004136992.1| (PREDICTED: armadillo repeat-containing protein 6 [Cucumis sativus]) HSP 1 Score: 148.3 bits (373), Expect = 6.1e-33 Identity = 77/78 (98.72%), Postives = 78/78 (100.00%), Query Frame = -2
BLAST of CU111388 vs. NCBI nr
Match: gi|659109856|ref|XP_008454917.1| (PREDICTED: armadillo repeat-containing protein 6 [Cucumis melo]) HSP 1 Score: 145.2 bits (365), Expect = 5.2e-32 Identity = 74/78 (94.87%), Postives = 78/78 (100.00%), Query Frame = -2
BLAST of CU111388 vs. NCBI nr
Match: gi|947101277|gb|KRH49769.1| (hypothetical protein GLYMA_07G178400 [Glycine max]) HSP 1 Score: 125.6 bits (314), Expect = 4.3e-26 Identity = 62/78 (79.49%), Postives = 71/78 (91.03%), Query Frame = -2
BLAST of CU111388 vs. NCBI nr
Match: gi|356521205|ref|XP_003529247.1| (PREDICTED: armadillo repeat-containing protein 6 isoform X1 [Glycine max]) HSP 1 Score: 125.6 bits (314), Expect = 4.3e-26 Identity = 62/78 (79.49%), Postives = 71/78 (91.03%), Query Frame = -2
BLAST of CU111388 vs. NCBI nr
Match: gi|1012264713|ref|XP_015947058.1| (PREDICTED: armadillo repeat-containing protein 6 [Arachis duranensis]) HSP 1 Score: 125.2 bits (313), Expect = 5.6e-26 Identity = 61/78 (78.21%), Postives = 71/78 (91.03%), Query Frame = -2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|