CU110808 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GATTGCGGAGGCAATTGCAGATGCTCGTTGTTATCAAGTACTTCGTGCGAATGAAGTTGAGTTTGAAATTGTCTCAACTGAGAGGACAAATATTGTGGAGATACATAGTCGTGTGTGCTCCTGTCGTCGTTGGCAACTATATGGACTCCCTTGTGCTCATGCCGCTGCGGCTCTAATGTCCTGTGGGCAGAATGCTCATCTACTTGCTGAGCCTTGTTTCACTGTCACTAGTTACCGTAGAAACTTATTCACAAATGATATACCCAA
BLAST of CU110808 vs. TrEMBL
Match: A0A0A0LN02_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G094910 PE=4 SV=1) HSP 1 Score: 164.1 bits (414), Expect = 7.8e-38 Identity = 78/79 (98.73%), Postives = 78/79 (98.73%), Query Frame = 2
BLAST of CU110808 vs. TrEMBL
Match: A0A061FG29_THECC (MuDR family transposase isoform 1 OS=Theobroma cacao GN=TCM_035107 PE=4 SV=1) HSP 1 Score: 154.5 bits (389), Expect = 6.2e-35 Identity = 75/90 (83.33%), Postives = 79/90 (87.78%), Query Frame = 2
BLAST of CU110808 vs. TrEMBL
Match: A0A067JKI4_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_23146 PE=4 SV=1) HSP 1 Score: 154.5 bits (389), Expect = 6.2e-35 Identity = 75/90 (83.33%), Postives = 79/90 (87.78%), Query Frame = 2
BLAST of CU110808 vs. TrEMBL
Match: A0A0D2U3A4_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_013G180100 PE=4 SV=1) HSP 1 Score: 153.7 bits (387), Expect = 1.1e-34 Identity = 72/79 (91.14%), Postives = 76/79 (96.20%), Query Frame = 2
BLAST of CU110808 vs. TrEMBL
Match: V4UQJ9_9ROSI (Uncharacterized protein OS=Citrus clementina GN=CICLE_v100113371mg PE=4 SV=1) HSP 1 Score: 152.9 bits (385), Expect = 1.8e-34 Identity = 71/79 (89.87%), Postives = 74/79 (93.67%), Query Frame = 2
BLAST of CU110808 vs. NCBI nr
Match: gi|449442265|ref|XP_004138902.1| (PREDICTED: uncharacterized protein LOC101220272 [Cucumis sativus]) HSP 1 Score: 162.5 bits (410), Expect = 3.3e-37 Identity = 78/79 (98.73%), Postives = 78/79 (98.73%), Query Frame = 2
BLAST of CU110808 vs. NCBI nr
Match: gi|659082246|ref|XP_008441740.1| (PREDICTED: uncharacterized protein LOC103485812 [Cucumis melo]) HSP 1 Score: 162.5 bits (410), Expect = 3.3e-37 Identity = 78/79 (98.73%), Postives = 78/79 (98.73%), Query Frame = 2
BLAST of CU110808 vs. NCBI nr
Match: gi|802754907|ref|XP_012088790.1| (PREDICTED: uncharacterized protein LOC105647353 [Jatropha curcas]) HSP 1 Score: 153.3 bits (386), Expect = 2.0e-34 Identity = 75/90 (83.33%), Postives = 79/90 (87.78%), Query Frame = 2
BLAST of CU110808 vs. NCBI nr
Match: gi|590598964|ref|XP_007019050.1| (MuDR family transposase isoform 1 [Theobroma cacao]) HSP 1 Score: 153.3 bits (386), Expect = 2.0e-34 Identity = 75/90 (83.33%), Postives = 79/90 (87.78%), Query Frame = 2
BLAST of CU110808 vs. NCBI nr
Match: gi|823262209|ref|XP_012463849.1| (PREDICTED: uncharacterized protein LOC105783147 [Gossypium raimondii]) HSP 1 Score: 152.1 bits (383), Expect = 4.4e-34 Identity = 72/79 (91.14%), Postives = 76/79 (96.20%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|