CU110417 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGGCCGGGCTCTCGAAACCAACGGGACTTTTGTATTCATCCTCCAAAAATGGGAATCTCACGCGTTTCTTCTCTCCTTGCCGTCTTCCTCATTCTCGCTCCTCATTTTGTCTTCTCCATGGCGGCCGCCGTCGATTTCTCTGGCGACCACGAGCTTCTCTTCGTTCCCACCACGTCCGATTTCTTCGACGACAACGATGATTTCGGTTTCGGAATGGAGTTCCAGATGGACTCTGAGATCAATCGCCGAATTCTGGCG
BLAST of CU110417 vs. TrEMBL
Match: A0A0A0KBU7_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G194150 PE=4 SV=1) HSP 1 Score: 109.0 bits (271), Expect = 2.9e-21 Identity = 58/70 (82.86%), Postives = 58/70 (82.86%), Query Frame = 1
BLAST of CU110417 vs. NCBI nr
Match: gi|449450680|ref|XP_004143090.1| (PREDICTED: protein RALF-like 33 [Cucumis sativus]) HSP 1 Score: 108.2 bits (269), Expect = 7.1e-21 Identity = 58/70 (82.86%), Postives = 58/70 (82.86%), Query Frame = 1
BLAST of CU110417 vs. NCBI nr
Match: gi|659117160|ref|XP_008458453.1| (PREDICTED: protein RALF-like 33 [Cucumis melo]) HSP 1 Score: 92.8 bits (229), Expect = 3.1e-16 Identity = 52/71 (73.24%), Postives = 55/71 (77.46%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|