CU110349 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GACCTCCATTTTCTCTTCTCCTTCTCCCCAAGTTTCTCCTCTCTACCTTTCCCACTTTCTGCCATGATGAAAATCCCCAAAAGATTTAGCCCTAAACGCCTCTTCCGATCCAAAAAGCATCACTCCGCCGACGTATCCCGCTCGGATCCACCCTCTTTCGGCTCCGGTACCTCCTCTTCCTCGTCCTCTTCCGAGAATTTCTTCAAAGCTAACACCGTGAACACCGGTTACGGAACCCCGACTAGCGTTCTGGACTCGGACGGGAGGGGGAACGAGGGGGTTGTGTCGAGGAAGGAACTGGAGGCGATTCTTAGCCGGATCGCGTCAGAGGAAGAGGTTGCGATGATGTTGCGCGAAGTGGATAGCGGGGGCGATGGGGTTCATACGGTTGGAGGAATTGATGGCTCGGGTGGGGTCGGGTGAAGCGGCGGGAGAGTCGGAGATGCGGGAGACGTTTGAGTTTTTTGACGCGGATCAGGATGGGAGGATCACGGCGGAGGAGCTTCACGGGGTTTTTAATCAATAGGAGATGAGCGGTGCACGTTAGAGTATTG
BLAST of CU110349 vs. Swiss-Prot
Match: CML36_ARATH (Probable calcium-binding protein CML36 OS=Arabidopsis thaliana GN=CML36 PE=2 SV=1) HSP 1 Score: 54.3 bits (129), Expect = 1.6e-06 Identity = 30/49 (61.22%), Postives = 37/49 (75.51%), Query Frame = 2
HSP 2 Score: 42.4 bits (98), Expect = 6.4e-03 Identity = 21/41 (51.22%), Postives = 28/41 (68.29%), Query Frame = 1
BLAST of CU110349 vs. TrEMBL
Match: A0A0A0L0H1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G355130 PE=4 SV=1) HSP 1 Score: 167.2 bits (422), Expect = 1.9e-38 Identity = 87/104 (83.65%), Postives = 87/104 (83.65%), Query Frame = 1
BLAST of CU110349 vs. TrEMBL
Match: A0A0A0L0H1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G355130 PE=4 SV=1) HSP 1 Score: 97.8 bits (242), Expect = 1.4e-17 Identity = 48/51 (94.12%), Postives = 49/51 (96.08%), Query Frame = 2
HSP 2 Score: 62.8 bits (151), Expect = 5.1e-07 Identity = 31/50 (62.00%), Postives = 38/50 (76.00%), Query Frame = 2
BLAST of CU110349 vs. TrEMBL
Match: W9RJF8_9ROSA (Putative calcium-binding protein CML36 OS=Morus notabilis GN=L484_015534 PE=4 SV=1) HSP 1 Score: 43.1 bits (100), Expect = 4.2e-01 Identity = 24/42 (57.14%), Postives = 29/42 (69.05%), Query Frame = 1
HSP 2 Score: 62.0 bits (149), Expect = 8.7e-07 Identity = 31/51 (60.78%), Postives = 40/51 (78.43%), Query Frame = 2
BLAST of CU110349 vs. TrEMBL
Match: A0A067DGT9_CITSI (Uncharacterized protein OS=Citrus sinensis GN=CISIN_1g027592mg PE=4 SV=1) HSP 1 Score: 48.1 bits (113), Expect = 1.3e-02 Identity = 47/134 (35.07%), Postives = 56/134 (41.79%), Query Frame = 1
HSP 2 Score: 62.0 bits (149), Expect = 8.7e-07 Identity = 31/51 (60.78%), Postives = 40/51 (78.43%), Query Frame = 2
BLAST of CU110349 vs. TrEMBL
Match: V4SC13_9ROSI (Uncharacterized protein OS=Citrus clementina GN=CICLE_v10005842mg PE=4 SV=1) HSP 1 Score: 48.1 bits (113), Expect = 1.3e-02 Identity = 47/134 (35.07%), Postives = 56/134 (41.79%), Query Frame = 1
HSP 2 Score: 61.6 bits (148), Expect = 1.1e-06 Identity = 30/47 (63.83%), Postives = 38/47 (80.85%), Query Frame = 2
BLAST of CU110349 vs. NCBI nr
Match: gi|449467126|ref|XP_004151276.1| (PREDICTED: probable calcium-binding protein CML36 [Cucumis sativus]) HSP 1 Score: 164.1 bits (414), Expect = 2.3e-37 Identity = 87/104 (83.65%), Postives = 87/104 (83.65%), Query Frame = 1
BLAST of CU110349 vs. NCBI nr
Match: gi|659115502|ref|XP_008457589.1| (PREDICTED: probable calcium-binding protein CML36 [Cucumis melo]) HSP 1 Score: 147.5 bits (371), Expect = 2.3e-32 Identity = 80/104 (76.92%), Postives = 82/104 (78.85%), Query Frame = 1
BLAST of CU110349 vs. NCBI nr
Match: gi|703123116|ref|XP_010102734.1| (putative calcium-binding protein CML36 [Morus notabilis]) HSP 1 Score: 62.4 bits (150), Expect = 9.6e-07 Identity = 31/50 (62.00%), Postives = 38/50 (76.00%), Query Frame = 2
BLAST of CU110349 vs. NCBI nr
Match: gi|567857156|ref|XP_006421261.1| (hypothetical protein CICLE_v10005842mg [Citrus clementina]) HSP 1 Score: 62.0 bits (149), Expect = 1.3e-06 Identity = 31/51 (60.78%), Postives = 40/51 (78.43%), Query Frame = 2
BLAST of CU110349 vs. NCBI nr
Match: gi|568877049|ref|XP_006491566.1| (PREDICTED: probable calcium-binding protein CML36 [Citrus sinensis]) HSP 1 Score: 62.0 bits (149), Expect = 1.3e-06 Identity = 31/51 (60.78%), Postives = 40/51 (78.43%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|