CU110000 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGGCCGGGGAGAATAACATTGAATTAGAGATGACGGGATTTGGGCATGGACTGCGTGTAATTGGGAGACAGATGCATCTCCTTCATCAACGTGAAGGTCCATCAGAGGTTCTAAAGGGAAAGATCGCAGAGCTGGAGAAATTTAGGAAGATGAAGAGAAGTACGAAGAAGGATCAGTTCACTGTGGACGTTCCTGAATCAAATTCCTTCCTTGATACTCCTTCTATGCCCATGATCCTC
BLAST of CU110000 vs. TrEMBL
Match: A0A0A0LR33_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G000630 PE=4 SV=1) HSP 1 Score: 143.7 bits (361), Expect = 9.8e-32 Identity = 70/70 (100.00%), Postives = 70/70 (100.00%), Query Frame = 3
BLAST of CU110000 vs. TrEMBL
Match: B9NF27_POPTR (Uncharacterized protein OS=Populus trichocarpa GN=POPTR_0014s16740g PE=4 SV=1) HSP 1 Score: 69.3 bits (168), Expect = 2.3e-09 Identity = 36/69 (52.17%), Postives = 45/69 (65.22%), Query Frame = 3
BLAST of CU110000 vs. TrEMBL
Match: A0A067E7B0_CITSI (Uncharacterized protein (Fragment) OS=Citrus sinensis GN=CISIN_1g038886mg PE=4 SV=1) HSP 1 Score: 69.3 bits (168), Expect = 2.3e-09 Identity = 39/70 (55.71%), Postives = 48/70 (68.57%), Query Frame = 3
BLAST of CU110000 vs. TrEMBL
Match: V4UA82_9ROSI (Uncharacterized protein OS=Citrus clementina GN=CICLE_v10016955mg PE=4 SV=1) HSP 1 Score: 69.3 bits (168), Expect = 2.3e-09 Identity = 39/70 (55.71%), Postives = 48/70 (68.57%), Query Frame = 3
BLAST of CU110000 vs. TrEMBL
Match: A0A0V0HEU4_SOLCH (Putative cytoplasmic dynein 2 light intermediate chain 1-like OS=Solanum chacoense PE=4 SV=1) HSP 1 Score: 66.2 bits (160), Expect = 2.0e-08 Identity = 34/64 (53.12%), Postives = 45/64 (70.31%), Query Frame = 3
BLAST of CU110000 vs. NCBI nr
Match: gi|449440500|ref|XP_004138022.1| (PREDICTED: uncharacterized protein LOC101207324 [Cucumis sativus]) HSP 1 Score: 141.0 bits (354), Expect = 9.1e-31 Identity = 70/70 (100.00%), Postives = 70/70 (100.00%), Query Frame = 3
BLAST of CU110000 vs. NCBI nr
Match: gi|659128798|ref|XP_008464375.1| (PREDICTED: uncharacterized protein LOC103502279 isoform X2 [Cucumis melo]) HSP 1 Score: 127.1 bits (318), Expect = 1.4e-26 Identity = 63/70 (90.00%), Postives = 66/70 (94.29%), Query Frame = 3
BLAST of CU110000 vs. NCBI nr
Match: gi|659128795|ref|XP_008464374.1| (PREDICTED: uncharacterized protein LOC103502279 isoform X1 [Cucumis melo]) HSP 1 Score: 127.1 bits (318), Expect = 1.4e-26 Identity = 63/70 (90.00%), Postives = 66/70 (94.29%), Query Frame = 3
BLAST of CU110000 vs. NCBI nr
Match: gi|747076668|ref|XP_011085414.1| (PREDICTED: uncharacterized protein LOC105167409 [Sesamum indicum]) HSP 1 Score: 68.6 bits (166), Expect = 5.8e-09 Identity = 39/70 (55.71%), Postives = 49/70 (70.00%), Query Frame = 3
BLAST of CU110000 vs. NCBI nr
Match: gi|567911033|ref|XP_006447830.1| (hypothetical protein CICLE_v10016955mg [Citrus clementina]) HSP 1 Score: 66.6 bits (161), Expect = 2.2e-08 Identity = 39/70 (55.71%), Postives = 48/70 (68.57%), Query Frame = 3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|