|
|
| Name | CU109163 |
|---|
| Type | transcribed_cluster |
|---|
| Organism | Cucumis. sativus (Cucumber (Chinese Long) v2) |
|---|
| Description | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein |
|---|
| Location | Chr3 : 7417441 .. 7417561 (-) |
|---|
| Sequence length | 122 |
|---|
The following sequences are available for this feature:
transcribed_cluster sequence TGGGGATCTCCAAGCCGAGCAGTCGAAAATCGAGGCTGTGGCTAAGAGTCTTTAGCTGGAAAAAGTTGAAGCAGAAGGATGATATTGCAATTTGGCAAAAACCAACCAACCATATTCACTGT
The following BLAST results are available for this feature:
| Match Name | E-value | Identity | Description | |
|---|
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|
