CU108784 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGGTATTAGCTCAAATCGAGAATGAGTATGGAAATGTGATGACACCAGCTTATGGAGATGCAGGAAAAGCATACATCAATTGGTGTGCTCAAATGGCCGAATCTCTCAATATTGGCGTTCCATGGATCATGTGCCAACAAAGTGATGCCCCACAACCTATGATTAATACATGCAATGGATTCTATTGTGATAACTTTACTCCAAACAATCCTAAGAGACCCAAAAT
BLAST of CU108784 vs. Swiss-Prot
Match: BGA15_ARATH (Beta-galactosidase 15 OS=Arabidopsis thaliana GN=BGAL15 PE=2 SV=1) HSP 1 Score: 134.0 bits (336), Expect = 6.5e-31 Identity = 57/74 (77.03%), Postives = 64/74 (86.49%), Query Frame = 3
BLAST of CU108784 vs. Swiss-Prot
Match: BGAL_BRAOL (Beta-galactosidase OS=Brassica oleracea PE=2 SV=1) HSP 1 Score: 122.9 bits (307), Expect = 1.5e-27 Identity = 54/74 (72.97%), Postives = 60/74 (81.08%), Query Frame = 3
BLAST of CU108784 vs. Swiss-Prot
Match: BGAL7_ARATH (Beta-galactosidase 7 OS=Arabidopsis thaliana GN=BGAL7 PE=2 SV=2) HSP 1 Score: 121.7 bits (304), Expect = 3.4e-27 Identity = 52/74 (70.27%), Postives = 60/74 (81.08%), Query Frame = 3
BLAST of CU108784 vs. Swiss-Prot
Match: BGAL6_ORYSJ (Beta-galactosidase 6 OS=Oryza sativa subsp. japonica GN=Os03g0255100 PE=1 SV=2) HSP 1 Score: 119.4 bits (298), Expect = 1.7e-26 Identity = 52/74 (70.27%), Postives = 60/74 (81.08%), Query Frame = 3
BLAST of CU108784 vs. Swiss-Prot
Match: BGAL8_ARATH (Beta-galactosidase 8 OS=Arabidopsis thaliana GN=BGAL8 PE=2 SV=2) HSP 1 Score: 114.4 bits (285), Expect = 5.4e-25 Identity = 51/74 (68.92%), Postives = 58/74 (78.38%), Query Frame = 3
BLAST of CU108784 vs. TrEMBL
Match: A0A0A0M006_CUCSA (Beta-galactosidase OS=Cucumis sativus GN=Csa_1G650110 PE=3 SV=1) HSP 1 Score: 163.7 bits (413), Expect = 8.6e-38 Identity = 72/74 (97.30%), Postives = 73/74 (98.65%), Query Frame = 3
BLAST of CU108784 vs. TrEMBL
Match: A0A0A0KRM6_CUCSA (Beta-galactosidase OS=Cucumis sativus GN=Csa_5G169120 PE=3 SV=1) HSP 1 Score: 163.7 bits (413), Expect = 8.6e-38 Identity = 72/74 (97.30%), Postives = 73/74 (98.65%), Query Frame = 3
BLAST of CU108784 vs. TrEMBL
Match: A0A0A0LDH9_CUCSA (Beta-galactosidase OS=Cucumis sativus GN=Csa_3G550690 PE=3 SV=1) HSP 1 Score: 150.6 bits (379), Expect = 7.5e-34 Identity = 66/74 (89.19%), Postives = 70/74 (94.59%), Query Frame = 3
BLAST of CU108784 vs. TrEMBL
Match: A0A0A0LXX7_CUCSA (Beta-galactosidase OS=Cucumis sativus GN=Csa_1G643050 PE=3 SV=1) HSP 1 Score: 149.1 bits (375), Expect = 2.2e-33 Identity = 66/74 (89.19%), Postives = 71/74 (95.95%), Query Frame = 3
BLAST of CU108784 vs. TrEMBL
Match: A0A022QEX1_ERYGU (Beta-galactosidase (Fragment) OS=Erythranthe guttata GN=MIMGU_mgv1a026608mg PE=3 SV=1) HSP 1 Score: 146.0 bits (367), Expect = 1.9e-32 Identity = 63/74 (85.14%), Postives = 69/74 (93.24%), Query Frame = 3
BLAST of CU108784 vs. NCBI nr
Match: gi|700195199|gb|KGN50376.1| (hypothetical protein Csa_5G169120 [Cucumis sativus]) HSP 1 Score: 164.9 bits (416), Expect = 5.5e-38 Identity = 72/74 (97.30%), Postives = 73/74 (98.65%), Query Frame = 3
BLAST of CU108784 vs. NCBI nr
Match: gi|778665392|ref|XP_011648551.1| (PREDICTED: beta-galactosidase 15-like [Cucumis sativus]) HSP 1 Score: 164.9 bits (416), Expect = 5.5e-38 Identity = 72/74 (97.30%), Postives = 73/74 (98.65%), Query Frame = 3
BLAST of CU108784 vs. NCBI nr
Match: gi|659074621|ref|XP_008437703.1| (PREDICTED: LOW QUALITY PROTEIN: beta-galactosidase 7-like [Cucumis melo]) HSP 1 Score: 163.3 bits (412), Expect = 1.6e-37 Identity = 71/74 (95.95%), Postives = 73/74 (98.65%), Query Frame = 3
BLAST of CU108784 vs. NCBI nr
Match: gi|659074629|ref|XP_008437707.1| (PREDICTED: beta-galactosidase 7-like, partial [Cucumis melo]) HSP 1 Score: 163.3 bits (412), Expect = 1.6e-37 Identity = 71/74 (95.95%), Postives = 73/74 (98.65%), Query Frame = 3
BLAST of CU108784 vs. NCBI nr
Match: gi|659102456|ref|XP_008452141.1| (PREDICTED: LOW QUALITY PROTEIN: beta-galactosidase 7-like [Cucumis melo]) HSP 1 Score: 156.0 bits (393), Expect = 2.6e-35 Identity = 68/74 (91.89%), Postives = 71/74 (95.95%), Query Frame = 3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|