CU108563 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GCTGCGAGGGGATGGCAAGGGTTGAGAGGCACGAGAGAGTGGATCAATGGCGGAGGAGGATGAGCAGAGCAGGTTTTCAAGCTTCGCCCATTAAAGTAATGGCTCAGGCAAAGCAGTGGATTGGGAAGTTTAAAGCTAATGAAGGCTACACTATTGTGGAAGAAAAGGGGTGTTTGGTTCTTGGCTGGAAGTCCAAGCCCATTGTTGCAGCCTCCTGCTGGAAATGACTAAAAAC
BLAST of CU108563 vs. Swiss-Prot
Match: GAI_ARATH (DELLA protein GAI OS=Arabidopsis thaliana GN=GAI PE=1 SV=1) HSP 1 Score: 78.6 bits (192), Expect = 3.4e-14 Identity = 35/76 (46.05%), Postives = 43/76 (56.58%), Query Frame = 3
BLAST of CU108563 vs. Swiss-Prot
Match: SLR1_ORYSI (DELLA protein SLR1 OS=Oryza sativa subsp. indica GN=SLR1 PE=3 SV=2) HSP 1 Score: 76.3 bits (186), Expect = 1.7e-13 Identity = 33/76 (43.42%), Postives = 45/76 (59.21%), Query Frame = 3
BLAST of CU108563 vs. Swiss-Prot
Match: SLR1_ORYSJ (DELLA protein SLR1 OS=Oryza sativa subsp. japonica GN=SLR1 PE=1 SV=1) HSP 1 Score: 76.3 bits (186), Expect = 1.7e-13 Identity = 33/76 (43.42%), Postives = 45/76 (59.21%), Query Frame = 3
BLAST of CU108563 vs. Swiss-Prot
Match: GAI_SOLLC (DELLA protein GAI OS=Solanum lycopersicum GN=GAI PE=2 SV=1) HSP 1 Score: 75.5 bits (184), Expect = 2.9e-13 Identity = 33/76 (43.42%), Postives = 44/76 (57.89%), Query Frame = 3
BLAST of CU108563 vs. Swiss-Prot
Match: RHT1_WHEAT (DELLA protein RHT-1 OS=Triticum aestivum GN=RHT1 PE=1 SV=1) HSP 1 Score: 74.7 bits (182), Expect = 4.9e-13 Identity = 32/76 (42.11%), Postives = 44/76 (57.89%), Query Frame = 3
BLAST of CU108563 vs. TrEMBL
Match: A0A0A0LU55_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G002800 PE=3 SV=1) HSP 1 Score: 159.1 bits (401), Expect = 2.2e-36 Identity = 74/74 (100.00%), Postives = 74/74 (100.00%), Query Frame = 3
BLAST of CU108563 vs. TrEMBL
Match: F6GSG2_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_17s0000g10300 PE=3 SV=1) HSP 1 Score: 144.1 bits (362), Expect = 7.3e-32 Identity = 66/74 (89.19%), Postives = 70/74 (94.59%), Query Frame = 3
BLAST of CU108563 vs. TrEMBL
Match: A0A067K4B2_JATCU (GRAS32 protein OS=Jatropha curcas GN=GRAS32 PE=2 SV=1) HSP 1 Score: 142.1 bits (357), Expect = 2.8e-31 Identity = 64/74 (86.49%), Postives = 70/74 (94.59%), Query Frame = 3
BLAST of CU108563 vs. TrEMBL
Match: B9RAM0_RICCO (DELLA protein RGL1, putative OS=Ricinus communis GN=RCOM_1507300 PE=3 SV=1) HSP 1 Score: 141.7 bits (356), Expect = 3.6e-31 Identity = 63/74 (85.14%), Postives = 70/74 (94.59%), Query Frame = 3
BLAST of CU108563 vs. TrEMBL
Match: A0A059A5Q6_EUCGR (Uncharacterized protein OS=Eucalyptus grandis GN=EUGRSUZ_K02752 PE=3 SV=1) HSP 1 Score: 139.4 bits (350), Expect = 1.8e-30 Identity = 63/74 (85.14%), Postives = 68/74 (91.89%), Query Frame = 3
BLAST of CU108563 vs. NCBI nr
Match: gi|449440598|ref|XP_004138071.1| (PREDICTED: DELLA protein GAI-like [Cucumis sativus]) HSP 1 Score: 159.1 bits (401), Expect = 3.2e-36 Identity = 74/74 (100.00%), Postives = 74/74 (100.00%), Query Frame = 3
BLAST of CU108563 vs. NCBI nr
Match: gi|700208415|gb|KGN63511.1| (hypothetical protein Csa_1G002800 [Cucumis sativus]) HSP 1 Score: 159.1 bits (401), Expect = 3.2e-36 Identity = 74/74 (100.00%), Postives = 74/74 (100.00%), Query Frame = 3
BLAST of CU108563 vs. NCBI nr
Match: gi|659129006|ref|XP_008464481.1| (PREDICTED: DELLA protein GAI-like [Cucumis melo]) HSP 1 Score: 157.9 bits (398), Expect = 7.0e-36 Identity = 73/74 (98.65%), Postives = 74/74 (100.00%), Query Frame = 3
BLAST of CU108563 vs. NCBI nr
Match: gi|297733612|emb|CBI14859.3| (unnamed protein product [Vitis vinifera]) HSP 1 Score: 144.1 bits (362), Expect = 1.0e-31 Identity = 66/74 (89.19%), Postives = 70/74 (94.59%), Query Frame = 3
BLAST of CU108563 vs. NCBI nr
Match: gi|225457448|ref|XP_002263040.1| (PREDICTED: DELLA protein GAI [Vitis vinifera]) HSP 1 Score: 144.1 bits (362), Expect = 1.0e-31 Identity = 66/74 (89.19%), Postives = 70/74 (94.59%), Query Frame = 3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|