CU107577 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TGGGGGTAGTAGTAGTAGTAGGTTTAGGTTAAGAAGAGAGAAGAAGATTTGAAGGATGATGAATAGTAATACCACCAAAACGATGCGTTTACCTCCTCGTAGATTAATGACGTCACCTAGGCCCAACAACAAGAGGAAAGAAAGAGAGGGCCTTGATTATGATGATGATGATGATGAGGCCCACCAACTGCCATTGACGGCTAAAGTACCCAAGCCGACGCCGACGCCGCATTCCAAGCAGCTCCTTGCCGGCTACTTGGCTCACGAGTTCCTCACTAAAGGAACGCTCTTCGGTCAGACTTGGGATAATCCAGATCCGGCTGCTAATGCTAACGCTAACGCTATGGCTTCTTCCTCTTCTTCCTTTTCTTCCTTTTCTTCTTCTCCTCCACTCACTACAGAGCCTCAAGAGAAGCGCCAAGCCGAAGCCCAATTACACCACAAC
BLAST of CU107577 vs. TrEMBL
Match: A0A0A0KDC0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G088100 PE=4 SV=1) HSP 1 Score: 202.2 bits (513), Expect = 4.4e-49 Identity = 100/129 (77.52%), Postives = 100/129 (77.52%), Query Frame = 2
BLAST of CU107577 vs. TrEMBL
Match: A0A0D2N9W4_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_001G255300 PE=4 SV=1) HSP 1 Score: 85.1 bits (209), Expect = 7.8e-14 Identity = 49/84 (58.33%), Postives = 53/84 (63.10%), Query Frame = 2
BLAST of CU107577 vs. TrEMBL
Match: I1LYN1_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_13G125500 PE=4 SV=1) HSP 1 Score: 82.8 bits (203), Expect = 3.8e-13 Identity = 46/85 (54.12%), Postives = 52/85 (61.18%), Query Frame = 2
BLAST of CU107577 vs. TrEMBL
Match: A0A067JRB3_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_17654 PE=4 SV=1) HSP 1 Score: 81.3 bits (199), Expect = 1.1e-12 Identity = 50/88 (56.82%), Postives = 53/88 (60.23%), Query Frame = 2
BLAST of CU107577 vs. TrEMBL
Match: I1L8G4_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_10G039100 PE=4 SV=1) HSP 1 Score: 78.6 bits (192), Expect = 7.3e-12 Identity = 46/89 (51.69%), Postives = 51/89 (57.30%), Query Frame = 2
BLAST of CU107577 vs. NCBI nr
Match: gi|778711659|ref|XP_011656778.1| (PREDICTED: uncharacterized protein LOC105435768 [Cucumis sativus]) HSP 1 Score: 197.6 bits (501), Expect = 1.5e-47 Identity = 100/129 (77.52%), Postives = 100/129 (77.52%), Query Frame = 2
BLAST of CU107577 vs. NCBI nr
Match: gi|659119983|ref|XP_008459949.1| (PREDICTED: uncharacterized protein LOC103498915 [Cucumis melo]) HSP 1 Score: 144.8 bits (364), Expect = 1.2e-31 Identity = 87/139 (62.59%), Postives = 91/139 (65.47%), Query Frame = 2
BLAST of CU107577 vs. NCBI nr
Match: gi|823128491|ref|XP_012443021.1| (PREDICTED: uncharacterized protein LOC105767949 [Gossypium raimondii]) HSP 1 Score: 82.4 bits (202), Expect = 7.2e-13 Identity = 49/84 (58.33%), Postives = 53/84 (63.10%), Query Frame = 2
BLAST of CU107577 vs. NCBI nr
Match: gi|1009147303|ref|XP_015891340.1| (PREDICTED: uncharacterized protein LOC107425815 [Ziziphus jujuba]) HSP 1 Score: 79.7 bits (195), Expect = 4.7e-12 Identity = 47/82 (57.32%), Postives = 53/82 (64.63%), Query Frame = 2
BLAST of CU107577 vs. NCBI nr
Match: gi|356548081|ref|XP_003542432.1| (PREDICTED: uncharacterized protein LOC100791482 [Glycine max]) HSP 1 Score: 79.7 bits (195), Expect = 4.7e-12 Identity = 46/85 (54.12%), Postives = 52/85 (61.18%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|