CU106185 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
AGCGAGCGAGCTTTGAGGATCCTGAGCGAGCTTCTCGAAAATGTCGTTGATGTAAGTCTGTTCATAATCCCCATGGCTTTGCTAGAGATTCCGATGTCGGGATGTACTTGCTTGAGGACTTTGAAGATGTAGATCTTGTAAGTCTCAATGCTCTTCTTGGCTCTCTTCTTCTTCTTATCGGAGGCGTCTTTGGGAAGCTTCTTCTCGGCTCGTGGCTTCTTCTCTGCCGGAGCTTTCTCGGCCTTCTTCTCCTCCGCCGCTGGCTTCTTCTCGGCGGGCTTCTTCTCAGCCTTTGGCGCCATTGCTAAATATAACGAAGGAATTTGGAGGTTGTATCGAAAATGCGAGTAAAAGCGAGTATTCCCCGGCCG
BLAST of CU106185 vs. Swiss-Prot
Match: H2B1_MEDTR (Probable histone H2B.1 OS=Medicago truncatula PE=3 SV=3) HSP 1 Score: 62.8 bits (151), Expect = 3.1e-09 Identity = 29/30 (96.67%), Postives = 28/30 (93.33%), Query Frame = -1
BLAST of CU106185 vs. Swiss-Prot
Match: H2B10_ARATH (Histone H2B.10 OS=Arabidopsis thaliana GN=At5g22880 PE=1 SV=3) HSP 1 Score: 62.8 bits (151), Expect = 3.1e-09 Identity = 29/30 (96.67%), Postives = 28/30 (93.33%), Query Frame = -1
BLAST of CU106185 vs. Swiss-Prot
Match: H2B11_ARATH (Histone H2B.11 OS=Arabidopsis thaliana GN=At5g59910 PE=1 SV=5) HSP 1 Score: 62.8 bits (151), Expect = 3.1e-09 Identity = 29/30 (96.67%), Postives = 28/30 (93.33%), Query Frame = -1
BLAST of CU106185 vs. Swiss-Prot
Match: H2B_GOSHI (Histone H2B OS=Gossypium hirsutum GN=HIS2B PE=2 SV=3) HSP 1 Score: 62.8 bits (151), Expect = 3.1e-09 Identity = 29/30 (96.67%), Postives = 28/30 (93.33%), Query Frame = -1
BLAST of CU106185 vs. Swiss-Prot
Match: H2B7_ARATH (Histone H2B.7 OS=Arabidopsis thaliana GN=At3g46030 PE=1 SV=3) HSP 1 Score: 62.8 bits (151), Expect = 3.1e-09 Identity = 29/30 (96.67%), Postives = 28/30 (93.33%), Query Frame = -1
BLAST of CU106185 vs. TrEMBL
Match: W1PIC1_AMBTC (Histone H2B OS=Amborella trichopoda GN=AMTR_s00012p00067980 PE=3 SV=1) HSP 1 Score: 63.2 bits (152), Expect = 2.6e-07 Identity = 30/30 (100.00%), Postives = 30/30 (100.00%), Query Frame = -1
BLAST of CU106185 vs. TrEMBL
Match: A0A0D2SV51_GOSRA (Histone H2B OS=Gossypium raimondii GN=B456_006G104400 PE=3 SV=1) HSP 1 Score: 63.2 bits (152), Expect = 2.6e-07 Identity = 30/30 (100.00%), Postives = 30/30 (100.00%), Query Frame = -1
BLAST of CU106185 vs. TrEMBL
Match: A0A0D2NPV9_GOSRA (Histone H2B OS=Gossypium raimondii GN=B456_006G104600 PE=3 SV=1) HSP 1 Score: 63.2 bits (152), Expect = 2.6e-07 Identity = 30/30 (100.00%), Postives = 30/30 (100.00%), Query Frame = -1
BLAST of CU106185 vs. TrEMBL
Match: A0A0D2S0C9_GOSRA (Histone H2B OS=Gossypium raimondii GN=B456_006G104500 PE=3 SV=1) HSP 1 Score: 63.2 bits (152), Expect = 2.6e-07 Identity = 30/30 (100.00%), Postives = 30/30 (100.00%), Query Frame = -1
BLAST of CU106185 vs. TrEMBL
Match: A0A0A0LST8_CUCSA (Histone H2B OS=Cucumis sativus GN=Csa_1G132680 PE=3 SV=1) HSP 1 Score: 63.2 bits (152), Expect = 2.6e-07 Identity = 30/30 (100.00%), Postives = 30/30 (100.00%), Query Frame = -1
BLAST of CU106185 vs. NCBI nr
Match: gi|971460092|emb|CUT18448.1| (H2B.3, partial [Lilium davidii var. unicolor]) HSP 1 Score: 63.2 bits (152), Expect = 3.8e-07 Identity = 30/30 (100.00%), Postives = 30/30 (100.00%), Query Frame = -1
BLAST of CU106185 vs. NCBI nr
Match: gi|641854133|gb|KDO72941.1| (hypothetical protein CISIN_1g032181mg [Citrus sinensis]) HSP 1 Score: 63.2 bits (152), Expect = 3.8e-07 Identity = 30/30 (100.00%), Postives = 30/30 (100.00%), Query Frame = -1
BLAST of CU106185 vs. NCBI nr
Match: gi|778659255|ref|XP_011654070.1| (PREDICTED: histone H2B.7 [Cucumis sativus]) HSP 1 Score: 63.2 bits (152), Expect = 3.8e-07 Identity = 30/30 (100.00%), Postives = 30/30 (100.00%), Query Frame = -1
BLAST of CU106185 vs. NCBI nr
Match: gi|297793547|ref|XP_002864658.1| (hypothetical protein ARALYDRAFT_496128 [Arabidopsis lyrata subsp. lyrata]) HSP 1 Score: 63.2 bits (152), Expect = 3.8e-07 Identity = 30/30 (100.00%), Postives = 30/30 (100.00%), Query Frame = -1
BLAST of CU106185 vs. NCBI nr
Match: gi|672114333|ref|XP_008776513.1| (PREDICTED: probable histone H2B.1 [Phoenix dactylifera]) HSP 1 Score: 63.2 bits (152), Expect = 3.8e-07 Identity = 30/30 (100.00%), Postives = 30/30 (100.00%), Query Frame = -1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|