CU104827 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
AAAGGTATCAAATTGGTATTTTCTTTTTCATAAAAAGTGAATAATTGTTATTTATTAAAAATAAATACATATTTTTTTGTTGATTTTGAAAATTATTCTAGGCGAAAAACTAAGTGAGCCTAAACACGCATCCCACACCGAGCCCAACAAACAATAGCCTACAACGAATATATGAGCTCATGTTCCATTGGGCCCAAACGAACATCCCGAAACTCATGAACTGAATAGGCACGAACCGACCCGAATACGATTAGTGTTTCTTCCTCTAAAAATCTTCGTCGCCGTAGCCAAGGTCATCCTCAACCTTCTGCGCTGCGTCCTCGGCGATCTGGTCCTCCACATACTCGACGCCCTCTCCGATGGCCAATCCACCTAAAATTCCAGCAGCCGCGCCCACCGCTAGCCCCGTCCCCATCCCGAACTTGCTTTTCTTCTTCTCCTCCGGCTGCCCATAGTACGTATGTTCGCCATACGCTGGCTGTCCATAACTTCCCTGACCGTACGATGGCTGCCCGTAATTCGATTGGCCGTATGGAGGCGCT
BLAST of CU104827 vs. TrEMBL
Match: A0A0A0LBH6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G183350 PE=4 SV=1) HSP 1 Score: 96.7 bits (239), Expect = 3.1e-17 Identity = 48/69 (69.57%), Postives = 48/69 (69.57%), Query Frame = -2
BLAST of CU104827 vs. TrEMBL
Match: A0A059DJS1_EUCGR (Uncharacterized protein OS=Eucalyptus grandis GN=EUGRSUZ_A02756 PE=4 SV=1) HSP 1 Score: 61.6 bits (148), Expect = 1.1e-06 Identity = 38/76 (50.00%), Postives = 44/76 (57.89%), Query Frame = -2
BLAST of CU104827 vs. NCBI nr
Match: gi|778679668|ref|XP_011651176.1| (PREDICTED: uncharacterized protein LOC101213996 [Cucumis sativus]) HSP 1 Score: 95.5 bits (236), Expect = 1.0e-16 Identity = 48/69 (69.57%), Postives = 48/69 (69.57%), Query Frame = -2
BLAST of CU104827 vs. NCBI nr
Match: gi|659077556|ref|XP_008439269.1| (PREDICTED: zinc finger matrin-type protein CG9776 [Cucumis melo]) HSP 1 Score: 82.4 bits (202), Expect = 8.8e-13 Identity = 43/71 (60.56%), Postives = 47/71 (66.20%), Query Frame = -2
BLAST of CU104827 vs. NCBI nr
Match: gi|743853074|ref|XP_010940561.1| (PREDICTED: transcription elongation factor SPT5 [Elaeis guineensis]) HSP 1 Score: 60.8 bits (146), Expect = 2.7e-06 Identity = 35/71 (49.30%), Postives = 39/71 (54.93%), Query Frame = -2
BLAST of CU104827 vs. NCBI nr
Match: gi|629126230|gb|KCW90655.1| (hypothetical protein EUGRSUZ_A02756 [Eucalyptus grandis]) HSP 1 Score: 60.5 bits (145), Expect = 3.6e-06 Identity = 38/76 (50.00%), Postives = 44/76 (57.89%), Query Frame = -2
BLAST of CU104827 vs. NCBI nr
Match: gi|702250087|ref|XP_010060582.1| (PREDICTED: uncharacterized protein LOC104448451 [Eucalyptus grandis]) HSP 1 Score: 60.5 bits (145), Expect = 3.6e-06 Identity = 38/76 (50.00%), Postives = 44/76 (57.89%), Query Frame = -2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|