CU104178 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TTCAGTTGTTCATAGCCATAAATTTAGTTTGATAATCTTCTTGCGCCAATGGAGATTCAATCGTTCCTTGGATGGAAGAACAATATGACAGTATTTCAAATAAAGTACCAAACAACATTTCACATTGAAGATTAAATTGTAGACCACTAAGCACCAGCCAGAACAACAAAATGGGAGTTGAACTTTATCATTTATTCACGTTATTACTTCAACTTTCTTAACAGAACAGTGAAGAAAATGGATACTAAACCATCGCCACTAGCATTACAAAAATTGTGGATGAAAAACTGTTATCTGTACATTTTCTTCAAGTGCGTGTGCTTGGAAAGGTGTTTGTCCTAAGAACCTGGATTTTCTTTAAATGTTGATAGAATCAACTCAAGTAAAGTGAGATTCAAACCATGTGAAGATCTTGTCAGCCTCTAAGCTAGTCATTTCGTGGTATGCAAAGGCAAGATTCAACTCTTCTTGAATGTGATTGGTTAAACTATTATCAGGTAAACTAA
BLAST of CU104178 vs. TrEMBL
Match: A0A0A0KH09_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G178940 PE=4 SV=1) HSP 1 Score: 89.0 bits (219), Expect = 6.1e-15 Identity = 41/41 (100.00%), Postives = 41/41 (100.00%), Query Frame = -3
BLAST of CU104178 vs. TrEMBL
Match: K4CGC7_SOLLC (Uncharacterized protein OS=Solanum lycopersicum PE=4 SV=1) HSP 1 Score: 69.3 bits (168), Expect = 5.0e-09 Identity = 28/40 (70.00%), Postives = 36/40 (90.00%), Query Frame = -3
BLAST of CU104178 vs. TrEMBL
Match: M1BGD2_SOLTU (Uncharacterized protein OS=Solanum tuberosum GN=PGSC0003DMG400017296 PE=4 SV=1) HSP 1 Score: 69.3 bits (168), Expect = 5.0e-09 Identity = 28/40 (70.00%), Postives = 36/40 (90.00%), Query Frame = -3
BLAST of CU104178 vs. TrEMBL
Match: A0A022QPR4_ERYGU (Uncharacterized protein OS=Erythranthe guttata GN=MIMGU_mgv1a008811mg PE=4 SV=1) HSP 1 Score: 68.9 bits (167), Expect = 6.5e-09 Identity = 30/38 (78.95%), Postives = 34/38 (89.47%), Query Frame = -3
BLAST of CU104178 vs. TrEMBL
Match: A0A0V0I8R2_SOLCH (Putative secretion-regulating guanine nucleotide exchange factor-like OS=Solanum chacoense PE=4 SV=1) HSP 1 Score: 68.6 bits (166), Expect = 8.5e-09 Identity = 28/40 (70.00%), Postives = 36/40 (90.00%), Query Frame = -3
BLAST of CU104178 vs. NCBI nr
Match: gi|449450852|ref|XP_004143176.1| (PREDICTED: uncharacterized protein LOC101217366 isoform X1 [Cucumis sativus]) HSP 1 Score: 89.0 bits (219), Expect = 8.7e-15 Identity = 41/41 (100.00%), Postives = 41/41 (100.00%), Query Frame = -3
BLAST of CU104178 vs. NCBI nr
Match: gi|659112903|ref|XP_008456361.1| (PREDICTED: uncharacterized protein LOC103496322 isoform X2 [Cucumis melo]) HSP 1 Score: 89.0 bits (219), Expect = 8.7e-15 Identity = 41/41 (100.00%), Postives = 41/41 (100.00%), Query Frame = -3
BLAST of CU104178 vs. NCBI nr
Match: gi|659112893|ref|XP_008456356.1| (PREDICTED: uncharacterized protein LOC103496322 isoform X1 [Cucumis melo]) HSP 1 Score: 89.0 bits (219), Expect = 8.7e-15 Identity = 41/41 (100.00%), Postives = 41/41 (100.00%), Query Frame = -3
BLAST of CU104178 vs. NCBI nr
Match: gi|778713742|ref|XP_011657111.1| (PREDICTED: uncharacterized protein LOC101217366 isoform X2 [Cucumis sativus]) HSP 1 Score: 75.9 bits (185), Expect = 7.7e-11 Identity = 35/35 (100.00%), Postives = 35/35 (100.00%), Query Frame = -3
BLAST of CU104178 vs. NCBI nr
Match: gi|659112907|ref|XP_008456364.1| (PREDICTED: uncharacterized protein LOC103496322 isoform X3 [Cucumis melo]) HSP 1 Score: 75.9 bits (185), Expect = 7.7e-11 Identity = 35/35 (100.00%), Postives = 35/35 (100.00%), Query Frame = -3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|