CU103812 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GTCGTGGTGTATCCGGTGTTCAACTCCAACTCCAGTTTCTTGCTACTCCGCCGCCGTTCCTGCAGCCGATACGCCGCCGGTGGGTGGTGGGGTGCTCCAGTTAGCTTTTGTACGATTGATCGGAATGTTGATGGGTCAGCTTCGACGAAGGTTGTGGTAGAGGAATGGACAACGGCGGTGGCGTTGGTGGTGGCCATGGGGAAGAGTATTTTTTTTGAAAAACAGAGAGAATGGGGGAAGAAGGGAGGAAGAGGGGGTTTTATTGAGTGGAGGAAAGAGAGAATTGGGAATTTAGTGGTTGAAATTGAAAAAAAAGTTTTGCTTTTTTCTAAATTATTATTTTTTGGGTCATAAGGAAGTCATTTCATTGGCGAAATGGGAATGATGTTGCAATGAAACTTCTTCAATGAAACCAAG
BLAST of CU103812 vs. Swiss-Prot
Match: VQ11_ARATH (VQ motif-containing protein 11 OS=Arabidopsis thaliana GN=VQ11 PE=1 SV=1) HSP 1 Score: 51.6 bits (122), Expect = 8.0e-06 Identity = 31/66 (46.97%), Postives = 37/66 (56.06%), Query Frame = -2
BLAST of CU103812 vs. TrEMBL
Match: A0A0A0K6W6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G432350 PE=4 SV=1) HSP 1 Score: 131.7 bits (330), Expect = 6.7e-28 Identity = 65/65 (100.00%), Postives = 65/65 (100.00%), Query Frame = -2
BLAST of CU103812 vs. TrEMBL
Match: A0A161ZWA8_DAUCA (Uncharacterized protein OS=Daucus carota subsp. sativus GN=DCAR_021355 PE=4 SV=1) HSP 1 Score: 60.5 bits (145), Expect = 1.9e-06 Identity = 36/82 (43.90%), Postives = 48/82 (58.54%), Query Frame = -2
BLAST of CU103812 vs. TrEMBL
Match: M5WR14_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa012011mg PE=4 SV=1) HSP 1 Score: 58.5 bits (140), Expect = 7.2e-06 Identity = 33/77 (42.86%), Postives = 43/77 (55.84%), Query Frame = -2
BLAST of CU103812 vs. TrEMBL
Match: A0A067KXP3_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_06106 PE=4 SV=1) HSP 1 Score: 58.2 bits (139), Expect = 9.5e-06 Identity = 33/74 (44.59%), Postives = 43/74 (58.11%), Query Frame = -2
BLAST of CU103812 vs. NCBI nr
Match: gi|778729019|ref|XP_004154113.2| (PREDICTED: VQ motif-containing protein 11 [Cucumis sativus]) HSP 1 Score: 128.3 bits (321), Expect = 1.1e-26 Identity = 65/65 (100.00%), Postives = 65/65 (100.00%), Query Frame = -2
BLAST of CU103812 vs. NCBI nr
Match: gi|659122976|ref|XP_008461422.1| (PREDICTED: uncharacterized protein LOC103500018 [Cucumis melo]) HSP 1 Score: 122.1 bits (305), Expect = 7.7e-25 Identity = 61/64 (95.31%), Postives = 64/64 (100.00%), Query Frame = -2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|