CU103655 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GTGCTATACCCTGAGTTCATTAGACATTTAAAGAAAATTTGTACAGTCACTTGGAAAATCAAAAGCATCAACTAATGGTTCTGAGAAGGCTAAAGTAGAAATTGACAATCAGAACAAACCATCTGAAACTGGGCCTTCTGATACGTTCGAATTGGCTGCTGATCTTCCTGAAGTTTCCCGAAACAGTTTAGATAGTCGGCTTGAGAAGTCAAAAAAAGCAAACAAGCCTGAGAAATCTCGTATGAGCACTGATCGCGTCGATAGGTTTAGGAAA
BLAST of CU103655 vs. TrEMBL
Match: A0A0A0L0Q0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G410820 PE=4 SV=1) HSP 1 Score: 158.7 bits (400), Expect = 3.4e-36 Identity = 80/81 (98.77%), Postives = 81/81 (100.00%), Query Frame = 2
BLAST of CU103655 vs. TrEMBL
Match: A0A061EI99_THECC (Alpha/beta-Hydrolases superfamily protein isoform 1 OS=Theobroma cacao GN=TCM_019386 PE=4 SV=1) HSP 1 Score: 132.1 bits (331), Expect = 3.4e-28 Identity = 66/81 (81.48%), Postives = 72/81 (88.89%), Query Frame = 2
BLAST of CU103655 vs. TrEMBL
Match: A0A061EHM1_THECC (Alpha/beta-Hydrolases superfamily protein isoform 2 OS=Theobroma cacao GN=TCM_019386 PE=4 SV=1) HSP 1 Score: 132.1 bits (331), Expect = 3.4e-28 Identity = 66/81 (81.48%), Postives = 72/81 (88.89%), Query Frame = 2
BLAST of CU103655 vs. TrEMBL
Match: A0A067KL51_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_13031 PE=4 SV=1) HSP 1 Score: 129.0 bits (323), Expect = 2.9e-27 Identity = 65/81 (80.25%), Postives = 74/81 (91.36%), Query Frame = 2
BLAST of CU103655 vs. TrEMBL
Match: A0A067KMF6_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_13025 PE=4 SV=1) HSP 1 Score: 128.3 bits (321), Expect = 4.9e-27 Identity = 65/81 (80.25%), Postives = 73/81 (90.12%), Query Frame = 2
BLAST of CU103655 vs. NCBI nr
Match: gi|778694559|ref|XP_011653830.1| (PREDICTED: alpha/beta hydrolase domain-containing protein 17B [Cucumis sativus]) HSP 1 Score: 149.1 bits (375), Expect = 3.9e-33 Identity = 80/81 (98.77%), Postives = 81/81 (100.00%), Query Frame = 2
BLAST of CU103655 vs. NCBI nr
Match: gi|659086749|ref|XP_008444091.1| (PREDICTED: alpha/beta hydrolase domain-containing protein 17B isoform X1 [Cucumis melo]) HSP 1 Score: 149.1 bits (375), Expect = 3.9e-33 Identity = 80/81 (98.77%), Postives = 81/81 (100.00%), Query Frame = 2
BLAST of CU103655 vs. NCBI nr
Match: gi|590652655|ref|XP_007033206.1| (Alpha/beta-Hydrolases superfamily protein isoform 1 [Theobroma cacao]) HSP 1 Score: 122.5 bits (306), Expect = 3.9e-25 Identity = 66/81 (81.48%), Postives = 72/81 (88.89%), Query Frame = 2
BLAST of CU103655 vs. NCBI nr
Match: gi|590652658|ref|XP_007033207.1| (Alpha/beta-Hydrolases superfamily protein isoform 2 [Theobroma cacao]) HSP 1 Score: 122.5 bits (306), Expect = 3.9e-25 Identity = 66/81 (81.48%), Postives = 72/81 (88.89%), Query Frame = 2
BLAST of CU103655 vs. NCBI nr
Match: gi|643723421|gb|KDP33000.1| (hypothetical protein JCGZ_13031 [Jatropha curcas]) HSP 1 Score: 119.8 bits (299), Expect = 2.5e-24 Identity = 65/81 (80.25%), Postives = 74/81 (91.36%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|