CU103467 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
ATGCTCCATCTGTAGCTGCTGAAGTTTGCACCTTCCACTGATCAAGTCCAAGTTGTAGAGTACCCTCAAGGTTAGCCTGCCTTACTGATTCTTCACTTGCATATCCCTGTAACAAATGAAGAAAGATTTCTGCTTCAAGGTCTTCAGATGACAACTTGGTTGAGCAAAGAACGTTTAACTTTTTTTCTTCACTGTAAGCAAGACATCTCTATAAGATGGTCTCCAACCCCTTAACGTCGACCGAG
BLAST of CU103467 vs. TrEMBL
Match: A0A0A0LT63_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G043030 PE=4 SV=1) HSP 1 Score: 118.2 bits (295), Expect = 4.5e-24 Identity = 60/61 (98.36%), Postives = 60/61 (98.36%), Query Frame = -2
BLAST of CU103467 vs. TrEMBL
Match: A0A0A0LT63_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G043030 PE=4 SV=1) HSP 1 Score: 45.8 bits (107), Expect = 2.9e-02 Identity = 20/21 (95.24%), Postives = 21/21 (100.00%), Query Frame = -3
HSP 2 Score: 73.6 bits (179), Expect = 1.3e-10 Identity = 40/74 (54.05%), Postives = 51/74 (68.92%), Query Frame = -2
BLAST of CU103467 vs. TrEMBL
Match: A0A0D2N3S3_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_001G069400 PE=4 SV=1) HSP 1 Score: 42.4 bits (98), Expect = 3.2e-01 Identity = 18/21 (85.71%), Postives = 21/21 (100.00%), Query Frame = -3
HSP 2 Score: 73.6 bits (179), Expect = 1.3e-10 Identity = 40/74 (54.05%), Postives = 51/74 (68.92%), Query Frame = -2
BLAST of CU103467 vs. TrEMBL
Match: A0A0D2LSI1_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_001G069400 PE=4 SV=1) HSP 1 Score: 42.4 bits (98), Expect = 3.2e-01 Identity = 18/21 (85.71%), Postives = 21/21 (100.00%), Query Frame = -3
HSP 2 Score: 73.6 bits (179), Expect = 1.3e-10 Identity = 40/74 (54.05%), Postives = 51/74 (68.92%), Query Frame = -2
BLAST of CU103467 vs. TrEMBL
Match: A0A0D2QIH7_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_001G069400 PE=4 SV=1) HSP 1 Score: 42.4 bits (98), Expect = 3.2e-01 Identity = 18/21 (85.71%), Postives = 21/21 (100.00%), Query Frame = -3
HSP 2 Score: 73.6 bits (179), Expect = 1.3e-10 Identity = 40/74 (54.05%), Postives = 51/74 (68.92%), Query Frame = -2
BLAST of CU103467 vs. NCBI nr
Match: gi|449439491|ref|XP_004137519.1| (PREDICTED: uncharacterized protein LOC101204111 [Cucumis sativus]) HSP 1 Score: 117.1 bits (292), Expect = 1.4e-23 Identity = 60/61 (98.36%), Postives = 60/61 (98.36%), Query Frame = -2
BLAST of CU103467 vs. NCBI nr
Match: gi|659066927|ref|XP_008467146.1| (PREDICTED: uncharacterized protein LOC103504561 isoform X2 [Cucumis melo]) HSP 1 Score: 106.7 bits (265), Expect = 2.0e-20 Identity = 55/61 (90.16%), Postives = 57/61 (93.44%), Query Frame = -2
BLAST of CU103467 vs. NCBI nr
Match: gi|659066929|ref|XP_008467154.1| (PREDICTED: uncharacterized protein LOC103504561 isoform X3 [Cucumis melo]) HSP 1 Score: 106.7 bits (265), Expect = 2.0e-20 Identity = 55/61 (90.16%), Postives = 57/61 (93.44%), Query Frame = -2
BLAST of CU103467 vs. NCBI nr
Match: gi|659066931|ref|XP_008467162.1| (PREDICTED: uncharacterized protein LOC103504561 isoform X4 [Cucumis melo]) HSP 1 Score: 106.7 bits (265), Expect = 2.0e-20 Identity = 55/61 (90.16%), Postives = 57/61 (93.44%), Query Frame = -2
BLAST of CU103467 vs. NCBI nr
Match: gi|659066925|ref|XP_008467136.1| (PREDICTED: uncharacterized protein LOC103504561 isoform X1 [Cucumis melo]) HSP 1 Score: 106.7 bits (265), Expect = 2.0e-20 Identity = 55/61 (90.16%), Postives = 57/61 (93.44%), Query Frame = -2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|