CU102839 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CTTTAATCAAAACGAAGGTGATTTTATTCACTTATATTATTATCTCTCAATTCTCAATCAAACCCAGCAAAAAACCTACATGTGTACATCAAATTTCCAATTTTGTACTAATTTAGAAGCAAAGGGTAGTTGGTGAGACAAAAACTAAAAAGAGGCTAATTTTCTGGCAGTGGAATCTCACCGAGAAGCTAATGACCAAAAGTTCAAGAGAAACGAAGGAGAAACAGCAAACCAGCTAATGAAAGCCATTGCAGTGGCGGACTCAAACTGTGCACAGTGGTTCACGCCACACTTGTTAAGGTCATTGCCTATAAGA
BLAST of CU102839 vs. Swiss-Prot
Match: CSPLT_ORYSJ (CASP-like protein 5A2 OS=Oryza sativa subsp. japonica GN=Os10g0343200 PE=2 SV=1) HSP 1 Score: 79.0 bits (193), Expect = 3.5e-14 Identity = 35/45 (77.78%), Postives = 38/45 (84.44%), Query Frame = -2
BLAST of CU102839 vs. Swiss-Prot
Match: CSPLV_ORYSJ (CASP-like protein 5A1 OS=Oryza sativa subsp. japonica GN=Os03g0206600 PE=2 SV=1) HSP 1 Score: 79.0 bits (193), Expect = 3.5e-14 Identity = 35/44 (79.55%), Postives = 37/44 (84.09%), Query Frame = -2
BLAST of CU102839 vs. Swiss-Prot
Match: CSPLT_ORYSI (CASP-like protein 5A2 OS=Oryza sativa subsp. indica GN=OsI_33147 PE=3 SV=1) HSP 1 Score: 79.0 bits (193), Expect = 3.5e-14 Identity = 35/45 (77.78%), Postives = 38/45 (84.44%), Query Frame = -2
BLAST of CU102839 vs. Swiss-Prot
Match: CSPLK_MAIZE (CASP-like protein 5A3 OS=Zea mays PE=2 SV=1) HSP 1 Score: 78.6 bits (192), Expect = 4.6e-14 Identity = 34/45 (75.56%), Postives = 38/45 (84.44%), Query Frame = -2
BLAST of CU102839 vs. Swiss-Prot
Match: CSPL6_ARATH (CASP-like protein 5A2 OS=Arabidopsis thaliana GN=At2g28370 PE=2 SV=1) HSP 1 Score: 77.8 bits (190), Expect = 7.9e-14 Identity = 34/45 (75.56%), Postives = 35/45 (77.78%), Query Frame = -2
BLAST of CU102839 vs. TrEMBL
Match: A0A0A0KF35_CUCSA (CASP-like protein OS=Cucumis sativus GN=Csa_6G445220 PE=3 SV=1) HSP 1 Score: 97.4 bits (241), Expect = 1.1e-17 Identity = 45/45 (100.00%), Postives = 45/45 (100.00%), Query Frame = -2
BLAST of CU102839 vs. TrEMBL
Match: M5WCK6_PRUPE (CASP-like protein OS=Prunus persica GN=PRUPE_ppa010839mg PE=3 SV=1) HSP 1 Score: 87.8 bits (216), Expect = 8.5e-15 Identity = 40/45 (88.89%), Postives = 42/45 (93.33%), Query Frame = -2
BLAST of CU102839 vs. TrEMBL
Match: M5VZW4_PRUPE (CASP-like protein OS=Prunus persica GN=PRUPE_ppa010839mg PE=3 SV=1) HSP 1 Score: 87.8 bits (216), Expect = 8.5e-15 Identity = 40/45 (88.89%), Postives = 42/45 (93.33%), Query Frame = -2
BLAST of CU102839 vs. TrEMBL
Match: A0A059A7F2_EUCGR (CASP-like protein OS=Eucalyptus grandis GN=EUGRSUZ_K03250 PE=3 SV=1) HSP 1 Score: 86.3 bits (212), Expect = 2.5e-14 Identity = 38/45 (84.44%), Postives = 41/45 (91.11%), Query Frame = -2
BLAST of CU102839 vs. TrEMBL
Match: A0A067K9Z9_JATCU (CASP-like protein OS=Jatropha curcas GN=JCGZ_16504 PE=3 SV=1) HSP 1 Score: 86.3 bits (212), Expect = 2.5e-14 Identity = 36/45 (80.00%), Postives = 44/45 (97.78%), Query Frame = -2
BLAST of CU102839 vs. NCBI nr
Match: gi|449451006|ref|XP_004143253.1| (PREDICTED: CASP-like protein 5A2 [Cucumis sativus]) HSP 1 Score: 97.4 bits (241), Expect = 1.5e-17 Identity = 45/45 (100.00%), Postives = 45/45 (100.00%), Query Frame = -2
BLAST of CU102839 vs. NCBI nr
Match: gi|645277787|ref|XP_008243939.1| (PREDICTED: CASP-like protein 2 [Prunus mume]) HSP 1 Score: 87.8 bits (216), Expect = 1.2e-14 Identity = 40/45 (88.89%), Postives = 42/45 (93.33%), Query Frame = -2
BLAST of CU102839 vs. NCBI nr
Match: gi|595829163|ref|XP_007205818.1| (hypothetical protein PRUPE_ppa010839mg [Prunus persica]) HSP 1 Score: 87.8 bits (216), Expect = 1.2e-14 Identity = 40/45 (88.89%), Postives = 42/45 (93.33%), Query Frame = -2
BLAST of CU102839 vs. NCBI nr
Match: gi|595829168|ref|XP_007205819.1| (hypothetical protein PRUPE_ppa010839mg [Prunus persica]) HSP 1 Score: 87.8 bits (216), Expect = 1.2e-14 Identity = 40/45 (88.89%), Postives = 42/45 (93.33%), Query Frame = -2
BLAST of CU102839 vs. NCBI nr
Match: gi|694318491|ref|XP_009342901.1| (PREDICTED: CASP-like protein Os03g0206600 [Pyrus x bretschneideri]) HSP 1 Score: 87.4 bits (215), Expect = 1.6e-14 Identity = 39/45 (86.67%), Postives = 42/45 (93.33%), Query Frame = -2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|