CU101031 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGACAAGCTCTGCGTAGTTCAACCGCCATGGCAGTGTCCGTTCCCAACACCTTGGATTCTTCTCCCATTCATCGCCTTCTTCCTCAAATTCGTTCTCACTCCTCGTCTGACCAAAGAGAGAATGCATCCCAACAAGAGTTTTCTCTGCCAATTTCGAGAAGGTCTGCAATTTTGATCTCTTCGCTACCTTTCACTCTCGTTTCTGTATCTCCGTCAAAGGCAAGAGAAAGAAGG
BLAST of CU101031 vs. TrEMBL
Match: A0A0A0L0S6_CUCSA (Peptidyl-prolyl cis-trans isomerase OS=Cucumis sativus GN=Csa_4G664330 PE=4 SV=1) HSP 1 Score: 97.1 bits (240), Expect = 1.0e-17 Identity = 52/69 (75.36%), Postives = 53/69 (76.81%), Query Frame = 1
BLAST of CU101031 vs. NCBI nr
Match: gi|449455631|ref|XP_004145556.1| (PREDICTED: peptidyl-prolyl cis-trans isomerase FKBP18, chloroplastic [Cucumis sativus]) HSP 1 Score: 95.5 bits (236), Expect = 4.3e-17 Identity = 52/69 (75.36%), Postives = 53/69 (76.81%), Query Frame = 1
BLAST of CU101031 vs. NCBI nr
Match: gi|659105087|ref|XP_008453010.1| (PREDICTED: peptidyl-prolyl cis-trans isomerase FKBP18, chloroplastic [Cucumis melo]) HSP 1 Score: 87.4 bits (215), Expect = 1.2e-14 Identity = 48/69 (69.57%), Postives = 50/69 (72.46%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|