CU098950 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GCTTTGAAGAAGAAGAAGAAGAAGATGAAGAAGATCAGGTGAATGAATCCATGTAGAAATGGGTGTTGTTGAGTGGGGGGGCTGTGGTTAGCCACGACGAATGGCAGTAAAGTAGTTGAAATCGTGGTGTTGGACCCTAAGTTGCTTTAGCCAAGAATCAGCCACGCTCAATAGAGACATCAATCTTTCTTGGTCCCTCCCATAATTACCAGAAATCCACACGTTTCCTTGCATCTTGTATGTGGCTAAAACCAAATGCTGCCAGCGATATCCCCTTCCCCTGCTTTTCTCTTCTTTTCTCCACTTTCAAATT
BLAST of CU098950 vs. TrEMBL
Match: A0A0A0KG73_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G128660 PE=4 SV=1) HSP 1 Score: 116.3 bits (290), Expect = 2.2e-23 Identity = 55/69 (79.71%), Postives = 59/69 (85.51%), Query Frame = -2
BLAST of CU098950 vs. TrEMBL
Match: M5WXB2_PRUPE (Uncharacterized protein (Fragment) OS=Prunus persica GN=PRUPE_ppa008669m1g PE=4 SV=1) HSP 1 Score: 109.4 bits (272), Expect = 2.7e-21 Identity = 51/69 (73.91%), Postives = 57/69 (82.61%), Query Frame = -2
BLAST of CU098950 vs. TrEMBL
Match: A0A061E2V2_THECC (F21B7.22 OS=Theobroma cacao GN=TCM_008030 PE=4 SV=1) HSP 1 Score: 109.4 bits (272), Expect = 2.7e-21 Identity = 51/69 (73.91%), Postives = 56/69 (81.16%), Query Frame = -2
BLAST of CU098950 vs. TrEMBL
Match: A0A0D2NG02_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_005G204000 PE=4 SV=1) HSP 1 Score: 109.0 bits (271), Expect = 3.5e-21 Identity = 51/69 (73.91%), Postives = 56/69 (81.16%), Query Frame = -2
BLAST of CU098950 vs. TrEMBL
Match: V4TJE8_9ROSI (Uncharacterized protein OS=Citrus clementina GN=CICLE_v10015991mg PE=4 SV=1) HSP 1 Score: 107.1 bits (266), Expect = 1.3e-20 Identity = 50/69 (72.46%), Postives = 55/69 (79.71%), Query Frame = -2
BLAST of CU098950 vs. NCBI nr
Match: gi|449444342|ref|XP_004139934.1| (PREDICTED: uncharacterized protein LOC101222318 [Cucumis sativus]) HSP 1 Score: 119.0 bits (297), Expect = 4.9e-24 Identity = 55/69 (79.71%), Postives = 59/69 (85.51%), Query Frame = -2
BLAST of CU098950 vs. NCBI nr
Match: gi|659094859|ref|XP_008448279.1| (PREDICTED: uncharacterized protein LOC103490514 [Cucumis melo]) HSP 1 Score: 119.0 bits (297), Expect = 4.9e-24 Identity = 55/69 (79.71%), Postives = 59/69 (85.51%), Query Frame = -2
BLAST of CU098950 vs. NCBI nr
Match: gi|694332913|ref|XP_009357071.1| (PREDICTED: uncharacterized protein LOC103947831 [Pyrus x bretschneideri]) HSP 1 Score: 114.8 bits (286), Expect = 9.2e-23 Identity = 51/69 (73.91%), Postives = 60/69 (86.96%), Query Frame = -2
BLAST of CU098950 vs. NCBI nr
Match: gi|658025429|ref|XP_008348115.1| (PREDICTED: uncharacterized protein LOC103411248 [Malus domestica]) HSP 1 Score: 113.6 bits (283), Expect = 2.1e-22 Identity = 51/69 (73.91%), Postives = 59/69 (85.51%), Query Frame = -2
BLAST of CU098950 vs. NCBI nr
Match: gi|1009127339|ref|XP_015880646.1| (PREDICTED: uncharacterized protein LOC107416641 [Ziziphus jujuba]) HSP 1 Score: 112.8 bits (281), Expect = 3.5e-22 Identity = 51/69 (73.91%), Postives = 57/69 (82.61%), Query Frame = -2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|