CU098665 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TGAGGTGGATTGTTTTCTTAACCTTATTTTGTTCTTTCGTTTTTTTGTTGTAGGTTTGGTAGAAAGGACTGAGCACGCCGAAAGACAAGTCTTGATCACCGAACCCAACTGTGGCAGTGATGGAATCATAGTAAACCGAGACTCGTTTATTGGGATTATATGCTCTTACCCCAAAACTAAAGGAATGCATTGAGTTGGGTGTCGGTCATGTCGAAGTTATGGACCTCAGCGCTTTCCACCGTGTAGCTCAGTCGTTTCGGCCTAACAGTT
BLAST of CU098665 vs. TrEMBL
Match: A0A0A0LVK3_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G132720 PE=4 SV=1) HSP 1 Score: 91.7 bits (226), Expect = 5.0e-16 Identity = 43/45 (95.56%), Postives = 44/45 (97.78%), Query Frame = -3
BLAST of CU098665 vs. TrEMBL
Match: A0A0A0LVK3_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G132720 PE=4 SV=1) HSP 1 Score: 59.7 bits (143), Expect = 2.1e-06 Identity = 28/28 (100.00%), Postives = 28/28 (100.00%), Query Frame = -2
HSP 2 Score: 63.2 bits (152), Expect = 1.9e-07 Identity = 28/44 (63.64%), Postives = 34/44 (77.27%), Query Frame = -3
BLAST of CU098665 vs. TrEMBL
Match: M5WCX8_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa011745mg PE=4 SV=1) HSP 1 Score: 33.1 bits (74), Expect = 2.1e+02 Identity = 12/27 (44.44%), Postives = 20/27 (74.07%), Query Frame = -2
HSP 2 Score: 59.3 bits (142), Expect = 2.7e-06 Identity = 23/43 (53.49%), Postives = 33/43 (76.74%), Query Frame = -3
BLAST of CU098665 vs. NCBI nr
Match: gi|778659278|ref|XP_011654115.1| (PREDICTED: uncharacterized protein At1g08160 [Cucumis sativus]) HSP 1 Score: 91.7 bits (226), Expect = 7.1e-16 Identity = 43/45 (95.56%), Postives = 44/45 (97.78%), Query Frame = -3
BLAST of CU098665 vs. NCBI nr
Match: gi|659072246|ref|XP_008464346.1| (PREDICTED: uncharacterized protein At1g08160 [Cucumis melo]) HSP 1 Score: 90.5 bits (223), Expect = 1.6e-15 Identity = 42/45 (93.33%), Postives = 44/45 (97.78%), Query Frame = -3
BLAST of CU098665 vs. NCBI nr
Match: gi|645217640|ref|XP_008226754.1| (PREDICTED: uncharacterized protein At1g08160-like [Prunus mume]) HSP 1 Score: 64.3 bits (155), Expect = 1.2e-07 Identity = 28/44 (63.64%), Postives = 34/44 (77.27%), Query Frame = -3
BLAST of CU098665 vs. NCBI nr
Match: gi|470119595|ref|XP_004295897.1| (PREDICTED: uncharacterized protein At1g08160 [Fragaria vesca subsp. vesca]) HSP 1 Score: 64.3 bits (155), Expect = 1.2e-07 Identity = 28/45 (62.22%), Postives = 34/45 (75.56%), Query Frame = -3
BLAST of CU098665 vs. NCBI nr
Match: gi|657986714|ref|XP_008385491.1| (PREDICTED: uncharacterized protein At1g08160-like [Malus domestica]) HSP 1 Score: 63.5 bits (153), Expect = 2.1e-07 Identity = 27/42 (64.29%), Postives = 33/42 (78.57%), Query Frame = -3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|