CU098304 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
AGGCAGAAGAAGCTATGTGGTGAAGAAGATTGCAGGAGATGTGGCGATTTTGATATGGATGAACCATGTATCGGAAAAAACCGATTGCTCTGTTTGTCATTCCACCAATGGTGTCTTCTGCCGAGCTTGTCTGAAAGTCAGATATGGTGAAGAAATGGAAGAAGTGATTAAGAACAAGAAATGGATGTGTCCTCATTGTGTGGAGGAGAAAGGATCAACTCATATTGGATATGCAACAGTTCATTGTGCTT
BLAST of CU098304 vs. TrEMBL
Match: A0A0A0LQX9_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G042940 PE=4 SV=1) HSP 1 Score: 107.5 bits (267), Expect = 8.2e-21 Identity = 46/46 (100.00%), Postives = 46/46 (100.00%), Query Frame = 2
BLAST of CU098304 vs. TrEMBL
Match: A0A0A0LQX9_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G042940 PE=4 SV=1) HSP 1 Score: 77.0 bits (188), Expect = 1.2e-11 Identity = 46/89 (51.69%), Postives = 52/89 (58.43%), Query Frame = 1
HSP 2 Score: 101.3 bits (251), Expect = 5.9e-19 Identity = 42/46 (91.30%), Postives = 45/46 (97.83%), Query Frame = 2
BLAST of CU098304 vs. TrEMBL
Match: B9SU83_RICCO (Putative uncharacterized protein OS=Ricinus communis GN=RCOM_0570410 PE=4 SV=1) HSP 1 Score: 61.2 bits (147), Expect = 6.7e-07 Identity = 36/88 (40.91%), Postives = 45/88 (51.14%), Query Frame = 1
HSP 2 Score: 99.4 bits (246), Expect = 2.2e-18 Identity = 40/46 (86.96%), Postives = 45/46 (97.83%), Query Frame = 2
BLAST of CU098304 vs. TrEMBL
Match: W9QWM5_9ROSA (Chaperone protein DnaJ OS=Morus notabilis GN=L484_019309 PE=3 SV=1) HSP 1 Score: 61.6 bits (148), Expect = 5.1e-07 Identity = 39/87 (44.83%), Postives = 47/87 (54.02%), Query Frame = 1
HSP 2 Score: 98.2 bits (243), Expect = 5.0e-18 Identity = 40/46 (86.96%), Postives = 44/46 (95.65%), Query Frame = 2
BLAST of CU098304 vs. TrEMBL
Match: G7KQ98_MEDTR (Uncharacterized protein OS=Medicago truncatula GN=MTR_6g070950 PE=4 SV=2) HSP 1 Score: 62.4 bits (150), Expect = 3.0e-07 Identity = 37/88 (42.05%), Postives = 46/88 (52.27%), Query Frame = 1
HSP 2 Score: 97.8 bits (242), Expect = 6.5e-18 Identity = 39/46 (84.78%), Postives = 44/46 (95.65%), Query Frame = 2
BLAST of CU098304 vs. NCBI nr
Match: gi|449439477|ref|XP_004137512.1| (PREDICTED: cell division cycle-associated protein 7 [Cucumis sativus]) HSP 1 Score: 108.2 bits (269), Expect = 6.9e-21 Identity = 46/46 (100.00%), Postives = 46/46 (100.00%), Query Frame = 2
BLAST of CU098304 vs. NCBI nr
Match: gi|659066900|ref|XP_008466442.1| (PREDICTED: cell division cycle-associated protein 7-like [Cucumis melo]) HSP 1 Score: 106.7 bits (265), Expect = 2.0e-20 Identity = 45/46 (97.83%), Postives = 46/46 (100.00%), Query Frame = 2
BLAST of CU098304 vs. NCBI nr
Match: gi|223530964|gb|EEF32821.1| (conserved hypothetical protein [Ricinus communis]) HSP 1 Score: 102.1 bits (253), Expect = 4.9e-19 Identity = 42/46 (91.30%), Postives = 45/46 (97.83%), Query Frame = 2
BLAST of CU098304 vs. NCBI nr
Match: gi|1000945921|ref|XP_015581102.1| (PREDICTED: cell division cycle-associated 7-like protein isoform X1 [Ricinus communis]) HSP 1 Score: 102.1 bits (253), Expect = 4.9e-19 Identity = 42/46 (91.30%), Postives = 45/46 (97.83%), Query Frame = 2
BLAST of CU098304 vs. NCBI nr
Match: gi|1000945923|ref|XP_015581103.1| (PREDICTED: cell division cycle-associated 7-like protein isoform X2 [Ricinus communis]) HSP 1 Score: 102.1 bits (253), Expect = 4.9e-19 Identity = 42/46 (91.30%), Postives = 45/46 (97.83%), Query Frame = 2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|