CU097366 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGAAAACAACAATCATAATATATAAAGGCGAAGATTATTTATAACTGAGACAAAAAGAAAGAAACAATATTTAAAAAAGAAAAAACAATCCATTTAATATATATGAGATAGGTAGATAGGGTAGGGGTTAATTGTTGGGCGGTTTAGGTATAATAGTTGATTGATCTTTCTCTACTTCACCTTCGGTTGTAATGACGGAGGAGACATAACTGAATGCTACGGAGGAATAATTGTCATGATCAGTGGCTGCACTCGTGCTCGTGGTAGTGGTAGTAGTTTTAGTTTTAGTTTTAGTTTGGTCTTGAAACTGCTTCTGGCAAGCTTGACAAGTGATCTCAAGAATGGTTGAGTTTATCTGCTTGATTGCTGCTTGTTTAAGGGCTGTGGCCTTATCTAATTCAGCCTGTGCCTGTTGCCTCATCCTCTTTGCATTCCCGAATTCTTCCTCTGCCATTTCTATTTGCCTCTTTGCCTGCTTCCTTGCTTCCTCCGCATATGCCTTCTCTGCCATCGCCACCCTTAGCTCCTCCCGTGCTTCTTCTCTAACA
BLAST of CU097366 vs. Swiss-Prot
Match: IDD16_ARATH (Protein indeterminate-domain 16 OS=Arabidopsis thaliana GN=IDD16 PE=2 SV=1) HSP 1 Score: 81.3 bits (199), Expect = 1.2e-14 Identity = 36/64 (56.25%), Postives = 53/64 (82.81%), Query Frame = -2
BLAST of CU097366 vs. Swiss-Prot
Match: IDD14_ARATH (Protein indeterminate-domain 14 OS=Arabidopsis thaliana GN=IDD14 PE=1 SV=1) HSP 1 Score: 72.0 bits (175), Expect = 7.5e-12 Identity = 33/63 (52.38%), Postives = 47/63 (74.60%), Query Frame = -2
BLAST of CU097366 vs. TrEMBL
Match: A0A0A0LPV5_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G029620 PE=4 SV=1) HSP 1 Score: 154.1 bits (388), Expect = 1.7e-34 Identity = 84/116 (72.41%), Postives = 85/116 (73.28%), Query Frame = -2
BLAST of CU097366 vs. TrEMBL
Match: A0A0L9VIL0_PHAAN (Uncharacterized protein OS=Phaseolus angularis GN=LR48_Vigan01g046300 PE=4 SV=1) HSP 1 Score: 109.8 bits (273), Expect = 3.6e-21 Identity = 54/67 (80.60%), Postives = 63/67 (94.03%), Query Frame = -2
BLAST of CU097366 vs. TrEMBL
Match: A0A151RFD5_CAJCA (Zinc finger protein MAGPIE OS=Cajanus cajan GN=KK1_037443 PE=4 SV=1) HSP 1 Score: 109.8 bits (273), Expect = 3.6e-21 Identity = 54/67 (80.60%), Postives = 63/67 (94.03%), Query Frame = -2
BLAST of CU097366 vs. TrEMBL
Match: A0A0S3TCE7_PHAAN (Uncharacterized protein OS=Vigna angularis var. angularis GN=Vigan.11G219800 PE=4 SV=1) HSP 1 Score: 109.8 bits (273), Expect = 3.6e-21 Identity = 54/67 (80.60%), Postives = 63/67 (94.03%), Query Frame = -2
BLAST of CU097366 vs. TrEMBL
Match: V7C5Q2_PHAVU (Uncharacterized protein OS=Phaseolus vulgaris GN=PHAVU_004G145900g PE=4 SV=1) HSP 1 Score: 109.4 bits (272), Expect = 4.7e-21 Identity = 54/67 (80.60%), Postives = 63/67 (94.03%), Query Frame = -2
BLAST of CU097366 vs. NCBI nr
Match: gi|778656670|ref|XP_011649488.1| (PREDICTED: protein SHOOT GRAVITROPISM 5 [Cucumis sativus]) HSP 1 Score: 145.2 bits (365), Expect = 1.1e-31 Identity = 84/116 (72.41%), Postives = 85/116 (73.28%), Query Frame = -2
BLAST of CU097366 vs. NCBI nr
Match: gi|659066251|ref|XP_008452902.1| (PREDICTED: protein SHOOT GRAVITROPISM 5-like [Cucumis melo]) HSP 1 Score: 140.2 bits (352), Expect = 3.6e-30 Identity = 84/118 (71.19%), Postives = 85/118 (72.03%), Query Frame = -2
BLAST of CU097366 vs. NCBI nr
Match: gi|920686925|gb|KOM30908.1| (hypothetical protein LR48_Vigan01g046300 [Vigna angularis]) HSP 1 Score: 101.3 bits (251), Expect = 1.8e-18 Identity = 54/67 (80.60%), Postives = 63/67 (94.03%), Query Frame = -2
BLAST of CU097366 vs. NCBI nr
Match: gi|1012329612|gb|KYP41183.1| (Zinc finger protein MAGPIE [Cajanus cajan]) HSP 1 Score: 101.3 bits (251), Expect = 1.8e-18 Identity = 54/67 (80.60%), Postives = 63/67 (94.03%), Query Frame = -2
BLAST of CU097366 vs. NCBI nr
Match: gi|593704505|ref|XP_007152626.1| (hypothetical protein PHAVU_004G145900g [Phaseolus vulgaris]) HSP 1 Score: 100.9 bits (250), Expect = 2.4e-18 Identity = 54/67 (80.60%), Postives = 63/67 (94.03%), Query Frame = -2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|