CU094867 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGAGGAGTACCGAGTCGACAAAGGAGCAGCTCCCAAGATGTTGAATTGTCTAATGTACAAACTTTCGTATTAATCGGTTTGGGGAGTTAGTAACAGAATATGGCAAGCCTCCTGGGTTCGATCGTGCCAGAGGAGTTGAAATTGGCAACAAGGATATCAAACTTGAGCACTTGGAGGAGGCATTCACCACATCTAATTGGATAGTTCGTATTTATAGAGTCAAACCACCAAATAACAGGTGGTGATTGATCTTTTTTCCCGAACCATCTTTGGAACGGCTACGAGTCAGATAGAACTCTGAGCAAGAGAGTCTTTGACATAGTGTTTATTCTAGGCAAAGAAAGTAAACTGGAATTTTGTTTCTACAACTTGAGCTGTAGTATCGAATGCGTCAATATTTTGAAATCTTTTTCAGAGATTCACAATGGATTCCTTTC
BLAST of CU094867 vs. Swiss-Prot
Match: STT3B_ARATH (Dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit STT3B OS=Arabidopsis thaliana GN=STT3B PE=2 SV=1) HSP 1 Score: 112.5 bits (280), Expect = 4.0e-24 Identity = 51/55 (92.73%), Postives = 51/55 (92.73%), Query Frame = 3
BLAST of CU094867 vs. Swiss-Prot
Match: STT3B_ORYSJ (Dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit STT3B OS=Oryza sativa subsp. japonica GN=STT3B PE=2 SV=2) HSP 1 Score: 108.6 bits (270), Expect = 5.8e-23 Identity = 49/55 (89.09%), Postives = 50/55 (90.91%), Query Frame = 3
BLAST of CU094867 vs. Swiss-Prot
Match: STT3B_HUMAN (Dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit STT3B OS=Homo sapiens GN=STT3B PE=1 SV=1) HSP 1 Score: 84.7 bits (208), Expect = 8.9e-16 Identity = 36/55 (65.45%), Postives = 43/55 (78.18%), Query Frame = 3
BLAST of CU094867 vs. Swiss-Prot
Match: STT3B_MOUSE (Dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit STT3B OS=Mus musculus GN=Stt3b PE=1 SV=2) HSP 1 Score: 84.7 bits (208), Expect = 8.9e-16 Identity = 36/55 (65.45%), Postives = 43/55 (78.18%), Query Frame = 3
BLAST of CU094867 vs. Swiss-Prot
Match: STT3A_HUMAN (Dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit STT3A OS=Homo sapiens GN=STT3A PE=1 SV=2) HSP 1 Score: 77.4 bits (189), Expect = 1.4e-13 Identity = 34/55 (61.82%), Postives = 42/55 (76.36%), Query Frame = 3
BLAST of CU094867 vs. TrEMBL
Match: A0A0A0LT73_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G043120 PE=4 SV=1) HSP 1 Score: 123.2 bits (308), Expect = 2.5e-25 Identity = 57/65 (87.69%), Postives = 61/65 (93.85%), Query Frame = 3
BLAST of CU094867 vs. TrEMBL
Match: B9I4Z5_POPTR (STAUROSPORIN AND TEMPERATURE SENSITIVE 3-LIKE B family protein OS=Populus trichocarpa GN=POPTR_0012s00900g PE=4 SV=2) HSP 1 Score: 120.9 bits (302), Expect = 1.2e-24 Identity = 55/65 (84.62%), Postives = 61/65 (93.85%), Query Frame = 3
BLAST of CU094867 vs. TrEMBL
Match: U5FLS2_POPTR (Uncharacterized protein OS=Populus trichocarpa GN=POPTR_0015s05610g PE=4 SV=1) HSP 1 Score: 120.9 bits (302), Expect = 1.2e-24 Identity = 55/65 (84.62%), Postives = 61/65 (93.85%), Query Frame = 3
BLAST of CU094867 vs. TrEMBL
Match: V4TSH7_9ROSI (Uncharacterized protein OS=Citrus clementina GN=CICLE_v10019005mg PE=4 SV=1) HSP 1 Score: 120.9 bits (302), Expect = 1.2e-24 Identity = 55/65 (84.62%), Postives = 61/65 (93.85%), Query Frame = 3
BLAST of CU094867 vs. TrEMBL
Match: A0A067DTL9_CITSI (Uncharacterized protein (Fragment) OS=Citrus sinensis GN=CISIN_1g0046351mg PE=4 SV=1) HSP 1 Score: 120.6 bits (301), Expect = 1.6e-24 Identity = 54/56 (96.43%), Postives = 56/56 (100.00%), Query Frame = 3
BLAST of CU094867 vs. NCBI nr
Match: gi|449439509|ref|XP_004137528.1| (PREDICTED: dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit STT3B [Cucumis sativus]) HSP 1 Score: 128.6 bits (322), Expect = 8.6e-27 Identity = 57/65 (87.69%), Postives = 61/65 (93.85%), Query Frame = 3
BLAST of CU094867 vs. NCBI nr
Match: gi|659066959|ref|XP_008467302.1| (PREDICTED: dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit STT3B [Cucumis melo]) HSP 1 Score: 127.5 bits (319), Expect = 1.9e-26 Identity = 56/65 (86.15%), Postives = 61/65 (93.85%), Query Frame = 3
BLAST of CU094867 vs. NCBI nr
Match: gi|743908599|ref|XP_011047756.1| (PREDICTED: dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit STT3B-like [Populus euphratica]) HSP 1 Score: 126.3 bits (316), Expect = 4.3e-26 Identity = 55/65 (84.62%), Postives = 61/65 (93.85%), Query Frame = 3
BLAST of CU094867 vs. NCBI nr
Match: gi|566196142|ref|XP_002318345.2| (STAUROSPORIN AND TEMPERATURE SENSITIVE 3-LIKE B family protein [Populus trichocarpa]) HSP 1 Score: 126.3 bits (316), Expect = 4.3e-26 Identity = 55/65 (84.62%), Postives = 61/65 (93.85%), Query Frame = 3
BLAST of CU094867 vs. NCBI nr
Match: gi|743919320|ref|XP_011003683.1| (PREDICTED: dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit STT3B [Populus euphratica]) HSP 1 Score: 126.3 bits (316), Expect = 4.3e-26 Identity = 55/65 (84.62%), Postives = 61/65 (93.85%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|