CU094402 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGGGGGAAATCTAATTACTTTATGCATTGATGATTGTGAAAAACATATGATACAGACTAGAAGCAAAAACTCCCACACTTACTACTACTTCACATCACTAGAAACTCTAGTAGATCATAAGTAAAAAAGAGAGAACGAAAGCTTATCTGTTGCGTAAATCTGCTCGCTTAAGCTCATCCATTAACAAATGTGCAACAGATTCGTACCCCATTTTCCGAGCTCTGTAAA
BLAST of CU094402 vs. TrEMBL
Match: A0A0A0LQX9_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G042940 PE=4 SV=1) HSP 1 Score: 57.4 bits (137), Expect = 8.8e-06 Identity = 27/27 (100.00%), Postives = 27/27 (100.00%), Query Frame = -3
BLAST of CU094402 vs. NCBI nr
Match: gi|449439477|ref|XP_004137512.1| (PREDICTED: cell division cycle-associated protein 7 [Cucumis sativus]) HSP 1 Score: 58.2 bits (139), Expect = 7.4e-06 Identity = 27/27 (100.00%), Postives = 27/27 (100.00%), Query Frame = -3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|