CU094117 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGGCCGGGGAGTGTTCATTCCTTCCCTCGCATCAATCTCCCTTTGCACATTATTTTCATTTCAGGCTTTTCTTCCTTCCTTCTAGGGTTTGAACAATCCGGTCGACTACTGCTCTTCTCTGTCATGTTTCCTTTGAGTTCTGTCCGATTCAAATCAGGATTTCTATAACCACCACCGCCGATTTTCCCCTTCAACCATTTGTCTGCTTGGAATCCGAAAATCCCCATTTCTTGTTTCTTCAAAATTTCCCTTCTGCATCATCATT
BLAST of CU094117 vs. TrEMBL
Match: A0A0A0KX61_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G055340 PE=4 SV=1) HSP 1 Score: 133.7 bits (335), Expect = 1.1e-28 Identity = 62/66 (93.94%), Postives = 63/66 (95.45%), Query Frame = -3
BLAST of CU094117 vs. NCBI nr
Match: gi|700198281|gb|KGN53439.1| (hypothetical protein Csa_4G055340 [Cucumis sativus]) HSP 1 Score: 129.0 bits (323), Expect = 3.9e-27 Identity = 62/66 (93.94%), Postives = 63/66 (95.45%), Query Frame = -3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|