CU093992 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TTGATTGACGATACAGCCTACGGTAATCAAGCGATCGGCTATTCCGTTTGAGATTGAATTTCGCACTGTTGGATCGAGAAACAGAGCTCTGCAATCCGGACAATGATTCTGAGCGTTTTCGAAATACAGTTTTGTTTTCGACTAATCTCTTCCTTCCAGGAACTTTTATCGGCGGTAATACGCGTAGAGTGATCATTGTTGAGAGGGAGCAATCTACCGCAGAAGATCAAATCCTCTGCGGGAAAATC
BLAST of CU093992 vs. TrEMBL
Match: A0A0A0LU50_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G423130 PE=4 SV=1) HSP 1 Score: 81.3 bits (199), Expect = 6.2e-13 Identity = 38/42 (90.48%), Postives = 38/42 (90.48%), Query Frame = -1
BLAST of CU093992 vs. TrEMBL
Match: A0A0A0LU50_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G423130 PE=4 SV=1) HSP 1 Score: 52.4 bits (124), Expect = 3.1e-04 Identity = 27/51 (52.94%), Postives = 31/51 (60.78%), Query Frame = -2
BLAST of CU093992 vs. NCBI nr
Match: gi|778660738|ref|XP_011656822.1| (PREDICTED: uncharacterized protein LOC105435774 [Cucumis sativus]) HSP 1 Score: 82.4 bits (202), Expect = 4.0e-13 Identity = 38/42 (90.48%), Postives = 38/42 (90.48%), Query Frame = -1
BLAST of CU093992 vs. NCBI nr
Match: gi|659107303|ref|XP_008453606.1| (PREDICTED: uncharacterized protein LOC103494265 [Cucumis melo]) HSP 1 Score: 73.2 bits (178), Expect = 2.4e-10 Identity = 36/42 (85.71%), Postives = 36/42 (85.71%), Query Frame = -1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|