CU093340 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGGTATTAGATGTTGAGGAATGGGAAAGCCAGGACTTGGATTACTGCCCTCCGCCGTATCTTCTGGCGGAAGGACGAGTTAACGACAACGACAAAGCGTCCGATGAACAACCTCCAAGTCTTTCTGAGCCTCCGTCGCGGGCTTGCCGTTCATGTTGATGATATATATATATATATATGCTACCTTTAATTTTACCATACCTGATCATCTCCCTAGTTTTTCTTCTTTACTTTAAATTTAGAT
BLAST of CU093340 vs. TrEMBL
Match: A0A0A0KK23_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G499860 PE=4 SV=1) HSP 1 Score: 109.8 bits (273), Expect = 1.6e-21 Identity = 48/50 (96.00%), Postives = 50/50 (100.00%), Query Frame = 3
BLAST of CU093340 vs. NCBI nr
Match: gi|700193538|gb|KGN48742.1| (hypothetical protein Csa_6G499860 [Cucumis sativus]) HSP 1 Score: 108.6 bits (270), Expect = 5.1e-21 Identity = 48/50 (96.00%), Postives = 50/50 (100.00%), Query Frame = 3
BLAST of CU093340 vs. NCBI nr
Match: gi|659080058|ref|XP_008440588.1| (PREDICTED: uncharacterized protein LOC103484965 [Cucumis melo]) HSP 1 Score: 93.6 bits (231), Expect = 1.7e-16 Identity = 44/52 (84.62%), Postives = 48/52 (92.31%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|