CU093325 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGAATCCACCGCCCTAAAATCTTCTGAACTTCTTCCATCGAATTCCCGTACTCCCCAACGCCTTCAGAATTCCCCTGTATTCATGCTTCGAGATCCTCCCGTCTTTGTTCGTGTCAAACTTGTTGAAGATCTGCTTTATCTCCTCCGAGCTCGGCTGCAGTGCCCGCCGGAGGCCTGAGCTCTGCCGGTCCTTGAAGGAGAACAGCCGGGAAGGTTCACGGAGGTAACTTTTTCTTTGAGACGTTGTACTGTAGTTCAAGGAAATTCGGGTTAATTGGCTTTTTTTTTAACGATGGGTTGCACTGTTTTTGTGTTTTTGGATGAAAATAAGATTGGTTTTCAAAATTTAGAGGAACCCAGATGGAATTTCAGTGGTTGAGTAGTGAAAACAAGGTTGCTCTGTTTTTTGTTTATTGAAACAGTGGAAGATAGGCAATGAAATTGAAGATCCCCGGCCG
BLAST of CU093325 vs. Swiss-Prot
Match: CML1_ARATH (Calmodulin-like protein 1 OS=Arabidopsis thaliana GN=CML1 PE=2 SV=1) HSP 1 Score: 63.2 bits (152), Expect = 2.9e-09 Identity = 35/81 (43.21%), Postives = 53/81 (65.43%), Query Frame = -2
BLAST of CU093325 vs. TrEMBL
Match: A0A0A0K804_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G073720 PE=4 SV=1) HSP 1 Score: 120.2 bits (300), Expect = 2.2e-24 Identity = 60/71 (84.51%), Postives = 65/71 (91.55%), Query Frame = -2
BLAST of CU093325 vs. TrEMBL
Match: A0A0A0K804_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G073720 PE=4 SV=1) HSP 1 Score: 44.7 bits (104), Expect = 1.2e-01 Identity = 37/96 (38.54%), Postives = 51/96 (53.12%), Query Frame = -1
HSP 2 Score: 82.4 bits (202), Expect = 5.2e-13 Identity = 43/87 (49.43%), Postives = 62/87 (71.26%), Query Frame = -2
BLAST of CU093325 vs. TrEMBL
Match: B9HS04_POPTR (Calmodulin-related family protein OS=Populus trichocarpa GN=POPTR_0009s10530g PE=4 SV=1) HSP 1 Score: 81.3 bits (199), Expect = 1.1e-12 Identity = 36/69 (52.17%), Postives = 52/69 (75.36%), Query Frame = -2
BLAST of CU093325 vs. TrEMBL
Match: B9HS04_POPTR (Calmodulin-related family protein OS=Populus trichocarpa GN=POPTR_0009s10530g PE=4 SV=1) HSP 1 Score: 30.4 bits (67), Expect = 2.3e+03 Identity = 13/30 (43.33%), Postives = 19/30 (63.33%), Query Frame = -2
HSP 2 Score: 81.3 bits (199), Expect = 1.1e-12 Identity = 39/70 (55.71%), Postives = 57/70 (81.43%), Query Frame = -2
BLAST of CU093325 vs. TrEMBL
Match: M5VNS5_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa011990mg PE=4 SV=1) HSP 1 Score: 80.1 bits (196), Expect = 2.6e-12 Identity = 33/69 (47.83%), Postives = 55/69 (79.71%), Query Frame = -2
BLAST of CU093325 vs. NCBI nr
Match: gi|778725125|ref|XP_004137114.2| (PREDICTED: calmodulin-like protein 1 [Cucumis sativus]) HSP 1 Score: 117.9 bits (294), Expect = 1.6e-23 Identity = 60/71 (84.51%), Postives = 65/71 (91.55%), Query Frame = -2
BLAST of CU093325 vs. NCBI nr
Match: gi|659109907|ref|XP_008454944.1| (PREDICTED: calmodulin-like protein 1 [Cucumis melo]) HSP 1 Score: 115.5 bits (288), Expect = 7.9e-23 Identity = 59/71 (83.10%), Postives = 64/71 (90.14%), Query Frame = -2
BLAST of CU093325 vs. NCBI nr
Match: gi|1009150194|ref|XP_015892888.1| (PREDICTED: calmodulin-like protein 1 [Ziziphus jujuba]) HSP 1 Score: 83.6 bits (205), Expect = 3.3e-13 Identity = 41/77 (53.25%), Postives = 61/77 (79.22%), Query Frame = -2
BLAST of CU093325 vs. NCBI nr
Match: gi|734399762|gb|KHN31070.1| (Calmodulin-like protein 1 [Glycine soja]) HSP 1 Score: 79.0 bits (193), Expect = 8.2e-12 Identity = 43/87 (49.43%), Postives = 62/87 (71.26%), Query Frame = -2
BLAST of CU093325 vs. NCBI nr
Match: gi|743794489|ref|XP_011000410.1| (PREDICTED: calmodulin-like protein 1 [Populus euphratica]) HSP 1 Score: 79.0 bits (193), Expect = 8.2e-12 Identity = 36/69 (52.17%), Postives = 52/69 (75.36%), Query Frame = -2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|