CU093295 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
AATAGCAACGTCTATTTACATTTTGTATTATTCTGCATAAATAATCTACAAGCAATTATTTGAAATGCATTATGAAATAACTATTTGCATATAGATTATTGCAGTTGCAGAATGCTTACGTGGAAGATGATGCTAAGGGTGTTTTCATTTTATGTGCTTTGCCGAGACCAGTGACCGGCAAAGGAATCACCTACAGAAACCTGAACTCGAAGAACCTCGTGGACAGCACCTCGGCTAAGCACCCCAAGAACGTCTTCCCCTTCTTCTGTCATGAGTTCTGCCAAAGAGACTCGACGAGTTTGTTGTTCGTCTCTCATACGGAATCCATAAAACCCCCCGGCCG
BLAST of CU093295 vs. TrEMBL
Match: A0A0A0L7T9_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G151470 PE=4 SV=1) HSP 1 Score: 121.7 bits (304), Expect = 5.7e-25 Identity = 60/60 (100.00%), Postives = 60/60 (100.00%), Query Frame = -3
BLAST of CU093295 vs. TrEMBL
Match: A0A067KV42_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_02020 PE=4 SV=1) HSP 1 Score: 81.3 bits (199), Expect = 8.5e-13 Identity = 36/60 (60.00%), Postives = 48/60 (80.00%), Query Frame = -3
BLAST of CU093295 vs. TrEMBL
Match: A0A061EMY2_THECC (Uncharacterized protein isoform 2 OS=Theobroma cacao GN=TCM_021137 PE=4 SV=1) HSP 1 Score: 77.4 bits (189), Expect = 1.2e-11 Identity = 37/59 (62.71%), Postives = 46/59 (77.97%), Query Frame = -3
BLAST of CU093295 vs. TrEMBL
Match: W9SER4_9ROSA (Uncharacterized protein OS=Morus notabilis GN=L484_008465 PE=4 SV=1) HSP 1 Score: 77.4 bits (189), Expect = 1.2e-11 Identity = 38/60 (63.33%), Postives = 44/60 (73.33%), Query Frame = -3
BLAST of CU093295 vs. TrEMBL
Match: A0A0L9TSP2_PHAAN (Uncharacterized protein OS=Phaseolus angularis GN=LR48_Vigan01g310600 PE=4 SV=1) HSP 1 Score: 74.3 bits (181), Expect = 1.0e-10 Identity = 36/58 (62.07%), Postives = 43/58 (74.14%), Query Frame = -3
BLAST of CU093295 vs. NCBI nr
Match: gi|659076667|ref|XP_008438803.1| (PREDICTED: uncharacterized protein LOC103483796 [Cucumis melo]) HSP 1 Score: 122.1 bits (305), Expect = 6.3e-25 Identity = 60/60 (100.00%), Postives = 60/60 (100.00%), Query Frame = -3
BLAST of CU093295 vs. NCBI nr
Match: gi|449432801|ref|XP_004134187.1| (PREDICTED: uncharacterized protein LOC101218430 [Cucumis sativus]) HSP 1 Score: 122.1 bits (305), Expect = 6.3e-25 Identity = 60/60 (100.00%), Postives = 60/60 (100.00%), Query Frame = -3
BLAST of CU093295 vs. NCBI nr
Match: gi|802578190|ref|XP_012069403.1| (PREDICTED: uncharacterized protein LOC105631825 [Jatropha curcas]) HSP 1 Score: 81.6 bits (200), Expect = 9.4e-13 Identity = 36/60 (60.00%), Postives = 48/60 (80.00%), Query Frame = -3
BLAST of CU093295 vs. NCBI nr
Match: gi|703132014|ref|XP_010105024.1| (hypothetical protein L484_008465 [Morus notabilis]) HSP 1 Score: 77.8 bits (190), Expect = 1.4e-11 Identity = 38/60 (63.33%), Postives = 44/60 (73.33%), Query Frame = -3
BLAST of CU093295 vs. NCBI nr
Match: gi|590660754|ref|XP_007035483.1| (Uncharacterized protein isoform 2 [Theobroma cacao]) HSP 1 Score: 77.4 bits (189), Expect = 1.8e-11 Identity = 37/59 (62.71%), Postives = 46/59 (77.97%), Query Frame = -3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|