CU092839 (transcribed_cluster) Cucumber (Chinese Long) v2 | Cucurbit Genomics Database (CuGenDB)


Name	CU092839
Type	transcribed_cluster
Organism	Cucumis. sativus (Cucumber (Chinese Long) v2)
Description	No hit
Location	Chr6 : 2318749 .. 2318810 (+)
Sequence length	66

The following sequences are available for this feature:

TTGTTTGTACAGAGTAACAGTTGAAGATAATAAGAGAATCACAGGGCTGTATTTTCATTTGCTGTT


Library category	ESTs
hermaphrodite flower library	2

The following BLAST results are available for this feature:


Match Name	E-value	Identity	Description

This transcribed_cluster is associated with the following gene feature(s):


Feature Name	Unique Name	Type
Csa6G022370	Csa6G022370	gene

The following EST feature(s) are a part of this transcribed_cluster:


Feature Name	Unique Name	Type
H0057581	H0057581	EST
H0121588	H0121588	EST