CU092635 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TTTTAGATGTATAGAAATGGCGAACTTGATGACGATGATGAACATGAACCAGTGTGGGTCTAAACCTGCATGGCTTCAAGCCCTTATGGCCGACACTTTCTTTGGAACTTGCTTGCTTCATGAGAACCGACCGACAAGTCCGAGAAGAACGTTTTTTGCTTGCATTGTTGTCTTAGTATTTGCCCTCACTGTCTTCCTTCTCACCGTTCTCATCCTCTTCTTCAGGTCAAGACGATATGTTTATCATGAT
BLAST of CU092635 vs. TrEMBL
Match: A0A0A0LUK6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G056980 PE=4 SV=1) HSP 1 Score: 90.9 bits (224), Expect = 7.9e-16 Identity = 47/78 (60.26%), Postives = 49/78 (62.82%), Query Frame = 2
BLAST of CU092635 vs. TrEMBL
Match: A0A0B2SU02_GLYSO (Uncharacterized protein OS=Glycine soja GN=glysoja_026401 PE=4 SV=1) HSP 1 Score: 74.7 bits (182), Expect = 5.9e-11 Identity = 35/71 (49.30%), Postives = 47/71 (66.20%), Query Frame = 1
BLAST of CU092635 vs. TrEMBL
Match: I1MGV8_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_15G158600 PE=4 SV=2) HSP 1 Score: 74.7 bits (182), Expect = 5.9e-11 Identity = 35/71 (49.30%), Postives = 47/71 (66.20%), Query Frame = 1
BLAST of CU092635 vs. TrEMBL
Match: V7AZ47_PHAVU (Uncharacterized protein OS=Phaseolus vulgaris GN=PHAVU_009G241300g PE=4 SV=1) HSP 1 Score: 74.7 bits (182), Expect = 5.9e-11 Identity = 36/66 (54.55%), Postives = 43/66 (65.15%), Query Frame = 1
BLAST of CU092635 vs. TrEMBL
Match: B9GYA0_POPTR (Uncharacterized protein OS=Populus trichocarpa GN=POPTR_0003s07310g PE=4 SV=2) HSP 1 Score: 74.3 bits (181), Expect = 7.7e-11 Identity = 40/77 (51.95%), Postives = 47/77 (61.04%), Query Frame = 1
BLAST of CU092635 vs. NCBI nr
Match: gi|778658266|ref|XP_011652401.1| (PREDICTED: uncharacterized protein LOC101205397 [Cucumis sativus]) HSP 1 Score: 90.9 bits (224), Expect = 1.1e-15 Identity = 47/78 (60.26%), Postives = 49/78 (62.82%), Query Frame = 2
BLAST of CU092635 vs. NCBI nr
Match: gi|922528093|ref|XP_013596776.1| (PREDICTED: uncharacterized protein LOC106304939 [Brassica oleracea var. oleracea]) HSP 1 Score: 79.7 bits (195), Expect = 2.6e-12 Identity = 38/81 (46.91%), Postives = 50/81 (61.73%), Query Frame = 1
BLAST of CU092635 vs. NCBI nr
Match: gi|356558252|ref|XP_003547421.1| (PREDICTED: uncharacterized protein LOC100806558 [Glycine max]) HSP 1 Score: 78.6 bits (192), Expect = 5.8e-12 Identity = 35/71 (49.30%), Postives = 47/71 (66.20%), Query Frame = 1
BLAST of CU092635 vs. NCBI nr
Match: gi|734435397|gb|KHN47712.1| (hypothetical protein glysoja_026401 [Glycine soja]) HSP 1 Score: 78.6 bits (192), Expect = 5.8e-12 Identity = 35/71 (49.30%), Postives = 47/71 (66.20%), Query Frame = 1
BLAST of CU092635 vs. NCBI nr
Match: gi|743864204|ref|XP_011031859.1| (PREDICTED: uncharacterized protein LOC105130858 [Populus euphratica]) HSP 1 Score: 78.2 bits (191), Expect = 7.6e-12 Identity = 40/76 (52.63%), Postives = 47/76 (61.84%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|