CU091114 (transcribed_cluster) Cucumber (Chinese Long) v2 | Cucurbit Genomics Database (CuGenDB)


Name	CU091114
Type	transcribed_cluster
Organism	Cucumis. sativus (Cucumber (Chinese Long) v2)
Description	Unknown protein
Location	Chr3 : 32330565 .. 32330694 (-)
Sequence length	131

The following sequences are available for this feature:

GATATTCTTCATTGCTTTTCTGTTTCTATTGGTTGTTTTTCTTGTGGGAGAGGCAATGGTAAGCCTGGGTAATGTGTGTGATCAGCTGGACTCTATTGGCGCCGTCCGCGAGTTGGCTCCATCGCCGTTCT


Library category	ESTs
gynoecious flower library	1
hermaphrodite flower library	1

The following BLAST results are available for this feature:


Match Name	E-value	Identity	Description

This transcribed_cluster is associated with the following gene feature(s):


Feature Name	Unique Name	Type
Csa3G822450	Csa3G822450	gene

The following EST feature(s) are a part of this transcribed_cluster:


Feature Name	Unique Name	Type
G0159587	G0159587	EST
H0170212	H0170212	EST