CU090698 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TGGGGGTACATGGGTGGAGCTGAAGAATTTGAGAAATCAATCGATTATTCTGGGGAACGATTGTTGCTTTTTCAATCGAAGCATCGGAGTTTGAAGGATGACAAAAAGATTGCGTTTATTACACGGATGTGAGAGAGGATGAATTTTGAAAAGAAGTACGAGTCGTGTGTTTGATGTTGAAAGGAAAAGGTTCGGAAACATAT
BLAST of CU090698 vs. TrEMBL
Match: A0A0A0KLM6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_5G118170 PE=4 SV=1) HSP 1 Score: 73.6 bits (179), Expect = 1.1e-10 Identity = 40/66 (60.61%), Postives = 41/66 (62.12%), Query Frame = 2
BLAST of CU090698 vs. NCBI nr
Match: gi|778698509|ref|XP_004149495.2| (PREDICTED: F-box protein At2g26160-like [Cucumis sativus]) HSP 1 Score: 77.8 bits (190), Expect = 8.0e-12 Identity = 40/66 (60.61%), Postives = 41/66 (62.12%), Query Frame = 2
BLAST of CU090698 vs. NCBI nr
Match: gi|659072629|ref|XP_008466513.1| (PREDICTED: putative F-box protein At1g65770 [Cucumis melo]) HSP 1 Score: 68.2 bits (165), Expect = 6.4e-09 Identity = 36/66 (54.55%), Postives = 38/66 (57.58%), Query Frame = 2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|