CU088951 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGGCCGGGGAATCCACCTTCTTCTTCTTCTTCCTTCTCTTCACAACGTCTATCTGCACAATTCTTTCTCCCTCTTCTCCTTTCCCTTTTCCCGAGGCCTTACCTATCATTTCAACACCAAAATTCCCACACCCACCTTCCATTTTCCTTGGTGCTTCCGCATTTTCCATCCCCCACCTGCCTACTTCCTTGAAATCAACGCATTTCATCTCTCCTCTCTTCCTATGATTCTAAATTTGTGATTTTGGATCACAGTATGATGTGGTTAAAACCGCTGATAAAATTACCATTATGGTTTGGGTAGGGGAAAGAAAAATGACTTAGAATG
BLAST of CU088951 vs. TrEMBL
Match: A0A0A0LKD2_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G062670 PE=4 SV=1) HSP 1 Score: 85.9 bits (211), Expect = 3.3e-14 Identity = 41/54 (75.93%), Postives = 41/54 (75.93%), Query Frame = -3
BLAST of CU088951 vs. NCBI nr
Match: gi|700206073|gb|KGN61192.1| (hypothetical protein Csa_2G062670 [Cucumis sativus]) HSP 1 Score: 86.3 bits (212), Expect = 3.6e-14 Identity = 41/54 (75.93%), Postives = 41/54 (75.93%), Query Frame = -3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|