CU088893 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
AACCCCATTGTAAAACATATGGAATAGGAAAGGGAAGTAAATGAAGTAAGGAAGAATAGTTACTTGGACGAAACAATCGTGGAAATGGAAGCGAATGAGTTTAGCACCAGCACGAATATCAGTTTCGATAGCTCTTTTGACTTCACGGCGGACAATGTTAGGGAGACGAGGGCAAGTTTGGTCGTAGAAATTCTCAGTGAGTTGGGCATAAGAGGTTACAAAGAAAACACAAAGAAACGAAAGGAAGAAACTGAAGGAACCCATCTTGTTTGGTC
BLAST of CU088893 vs. Swiss-Prot
Match: PERX_TOBAC (Lignin-forming anionic peroxidase OS=Nicotiana tabacum PE=2 SV=1) HSP 1 Score: 63.5 bits (153), Expect = 1.3e-09 Identity = 29/49 (59.18%), Postives = 33/49 (67.35%), Query Frame = -3
BLAST of CU088893 vs. Swiss-Prot
Match: PER2_CUCSA (Peroxidase 2 (Fragment) OS=Cucumis sativus PE=2 SV=1) HSP 1 Score: 63.5 bits (153), Expect = 1.3e-09 Identity = 27/41 (65.85%), Postives = 33/41 (80.49%), Query Frame = -3
BLAST of CU088893 vs. Swiss-Prot
Match: PERX_NICSY (Lignin-forming anionic peroxidase OS=Nicotiana sylvestris PE=2 SV=1) HSP 1 Score: 62.8 bits (151), Expect = 2.3e-09 Identity = 27/49 (55.10%), Postives = 32/49 (65.31%), Query Frame = -3
BLAST of CU088893 vs. Swiss-Prot
Match: PER53_ARATH (Peroxidase 53 OS=Arabidopsis thaliana GN=PER53 PE=1 SV=1) HSP 1 Score: 62.8 bits (151), Expect = 2.3e-09 Identity = 28/50 (56.00%), Postives = 32/50 (64.00%), Query Frame = -3
BLAST of CU088893 vs. Swiss-Prot
Match: PER54_ARATH (Peroxidase 54 OS=Arabidopsis thaliana GN=PER54 PE=2 SV=1) HSP 1 Score: 61.2 bits (147), Expect = 6.6e-09 Identity = 27/50 (54.00%), Postives = 31/50 (62.00%), Query Frame = -3
BLAST of CU088893 vs. TrEMBL
Match: A0A0A0L1T4_CUCSA (Peroxidase OS=Cucumis sativus GN=Csa_4G285770 PE=3 SV=1) HSP 1 Score: 109.4 bits (272), Expect = 2.4e-21 Identity = 51/51 (100.00%), Postives = 51/51 (100.00%), Query Frame = -3
BLAST of CU088893 vs. TrEMBL
Match: O65773_CUCPE (Peroxidase OS=Cucurbita pepo GN=aprx PE=2 SV=2) HSP 1 Score: 103.6 bits (257), Expect = 1.3e-19 Identity = 48/50 (96.00%), Postives = 49/50 (98.00%), Query Frame = -3
BLAST of CU088893 vs. TrEMBL
Match: Q19MQ5_CUCPE (Peroxidase OS=Cucurbita pepo GN=aprx PE=3 SV=1) HSP 1 Score: 103.6 bits (257), Expect = 1.3e-19 Identity = 48/50 (96.00%), Postives = 49/50 (98.00%), Query Frame = -3
BLAST of CU088893 vs. TrEMBL
Match: A0A0U2D7M1_LUFAE (Peroxidase OS=Luffa aegyptiaca PE=2 SV=1) HSP 1 Score: 100.1 bits (248), Expect = 1.4e-18 Identity = 46/50 (92.00%), Postives = 49/50 (98.00%), Query Frame = -3
BLAST of CU088893 vs. TrEMBL
Match: A0A0A0KZ63_CUCSA (Peroxidase OS=Cucumis sativus GN=Csa_4G285750 PE=3 SV=1) HSP 1 Score: 89.0 bits (219), Expect = 3.3e-15 Identity = 39/50 (78.00%), Postives = 46/50 (92.00%), Query Frame = -3
BLAST of CU088893 vs. NCBI nr
Match: gi|449448788|ref|XP_004142147.1| (PREDICTED: peroxidase 2-like [Cucumis sativus]) HSP 1 Score: 109.8 bits (273), Expect = 2.6e-21 Identity = 51/51 (100.00%), Postives = 51/51 (100.00%), Query Frame = -3
BLAST of CU088893 vs. NCBI nr
Match: gi|659097715|ref|XP_008449774.1| (PREDICTED: peroxidase 2-like [Cucumis melo]) HSP 1 Score: 108.2 bits (269), Expect = 7.5e-21 Identity = 50/51 (98.04%), Postives = 51/51 (100.00%), Query Frame = -3
BLAST of CU088893 vs. NCBI nr
Match: gi|99906997|gb|ABF68751.1| (class III peroxidase precursor [Cucurbita pepo]) HSP 1 Score: 104.0 bits (258), Expect = 1.4e-19 Identity = 48/50 (96.00%), Postives = 49/50 (98.00%), Query Frame = -3
BLAST of CU088893 vs. NCBI nr
Match: gi|3927894|emb|CAA76680.1| (peroxidase [Cucurbita pepo]) HSP 1 Score: 104.0 bits (258), Expect = 1.4e-19 Identity = 48/50 (96.00%), Postives = 49/50 (98.00%), Query Frame = -3
BLAST of CU088893 vs. NCBI nr
Match: gi|844289598|gb|AKN08989.1| (peroxidase [Luffa aegyptiaca]) HSP 1 Score: 100.5 bits (249), Expect = 1.6e-18 Identity = 46/50 (92.00%), Postives = 49/50 (98.00%), Query Frame = -3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|