CU088876 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGGTTGAATGCGGTAGAGATGGGAGTGGAGTTGGGATTGGCGGTAGGAAGAATATCAACGGAAACCGGGCAGGGCATAGTGGGGGCGGAGAAGATAGAGAGTGGTAAAAAAAG
BLAST of CU088876 vs. TrEMBL
Match: A0A0A0L4D9_CUCSA (Glycosyltransferase OS=Cucumis sativus GN=Csa_4G618510 PE=3 SV=1) HSP 1 Score: 58.5 bits (140), Expect = 1.9e-06 Identity = 33/37 (89.19%), Postives = 33/37 (89.19%), Query Frame = 1
BLAST of CU088876 vs. NCBI nr
Match: gi|778695494|ref|XP_004146062.2| (PREDICTED: anthocyanidin 3-O-glucosyltransferase 2-like [Cucumis sativus]) HSP 1 Score: 57.0 bits (136), Expect = 8.1e-06 Identity = 33/37 (89.19%), Postives = 33/37 (89.19%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|